L’eugenetica del Dottor E

Prequel n.2

“L’eugenetica del Dottor E”

Nei laboratori della FutureProg.

Qualche anno prima della grande caccia al programma.

Mentre tamburellava con la matita sui raccoglitori accumulati nello scaffale e ripieni di analisi di laboratorio effettuate in quei duri anni di lavoro e di campionatura, il Dottor “E”, così l’avevano ribattezzato i suoi più stretti collaboratori lì alla FutureProg, non poté fare a meno di rimuginare sugli imprevisti e a dir poco sconvolgenti risultati segreti del beta testing di “Sion 2”.

Un nome biblico per un programma che avrebbe dovuto gestire il lavoro complesso e delicato dei tanti laboratori di analisi cliniche sparsi nel mondo e messi in rete. Se gli affari fossero andati come aveva previsto il fiducioso amministratore delegato direttamente piombato dalla sede centrale per assistere ai primi vagiti dell’applicazione – … il mondo non sarebbe stato più lo stesso… – queste le esagerate e ottimistiche parole usate dal pezzo grosso durante un’innocua pausa caffé. Parole a cui non aveva mai dato o non aveva mai potuto dare, in quanto reso inoffensivo dalla mancanza di dati più “intimi”, la giusta importanza.

– Chissà perché un nome biblico – continuava a chiedersi il Dottor “E”. Forse per impressionare gli informatori impegnati nei loro giri danteschi alla ricerca di possibili acquirenti o forse per impressionare gli stessi acquirenti, compresi i politici impegnati nella complessa gestione sanitaria dei paesi rappresentati, facendo leva sulla loro reverenziale coscienza religiosa collettiva ben nascosta tra le pieghe più arcaiche del cervello.

Ora, però, conosceva il vero perché di quel nome. Ma era troppo tardi. O forse no…

Dunque, i contagiosi “Protocolli dei Savi Anziani di Sion” avevano finalmente trovato la loro terapia globale in quel programma informatico capace di gestire, tramite la Rete, i dati di migliaia di laboratori sparsi nel mondo, in barba alle più elementari leggi sulla privacy con cui i politici si facevano belli dinnanzi alle telecamere e agli elettori.

Dopo l’eclatante fallimento nazista del secolo scorso e la storica diluizione degli sforzi eugenetici in tanti piccoli rivoli insignificanti, presto dimenticati, la subdola risposta all’oltraggiosa fondazione dello Stato di Israele si era trasformata con il tempo in uno dei progetti più capillari della storia umana. Chi, almeno una volta durante la propria vita e per i motivi più disparati, non aveva avuto bisogno di compiere delle semplici e routinarie analisi del sangue o non aveva depositato la propria saliva per un semplice test infettivistico? Tutti… Già, proprio tutti. Prassi quasi quotidiana nell’allarmistica e ben curata società del terzo millennio. Almeno in quella ricca, quella che conta dal punto di vista economico e tecnologico.

– Che ingenuo, sono stato! – pensava il rinsavito Dottor “E” mentre ripercorreva mentalmente le fasi più importanti dell’elaborazione del “Pacchetto Sion 2”. Non solo gestione dei dati in Rete, dunque, ma anche ricerca eugenetica camuffata da propositi umanistici e di ordine pubblico – L’Organizzazione Mondiale della Sanità ci ha chiesto espressamente di compiere una ricerca su vasta scala, tramite “Sion 2”, di quei fattori genetici che predisporrebbero gli individui all’uso di droghe e alcol… per bloccare l’impressionante parabola di omicidi, suicidi, incidenti stradali e sul lavoro, in tutto il mondo… – gli avevano detto alla vigilia del beta testing.

– Dottor “E”… “E” come Eugenetica! – rise amaramente – Dunque i miei più stretti collaboratori, i miei “amici” qui alla FutureProg, sapevano e sanno?

Ora tutte le tessere di quel mosaico invisibile ma reale si stavano riordinando pian piano nella sua sconvolta psiche di essere umano deluso e sfruttato. “Sion 2” avrebbe dovuto funzionare pressappoco così: il programma che gestiva il computer interno agli analizzatori, oltre a svolgere le sue normali e banali funzioni sequenziali, sarebbe stato in grado, parallelamente, di compiere una precisa e non autorizzata ricerca genetica sui campioni di sangue giunti in laboratorio. Una ricerca capace di stanare, negli anfratti cromosomiali delle cellule sanguigne, le più insignificanti tracce genomiche israelite tramandate nel tempo e insabbiate dai naturali incroci che la moderna e libera società globalizzata rendeva possibile ormai da decenni ai suoi inconsapevoli figli da redimere.

Tutto era cominciato alcune settimane prima.

Durante le fasi finali del beta testing, il Dottor “E” non riusciva a spiegarsi quella sigla cifrata che di tanto in tanto compariva al lato del numero di campione: … E-45671-I, E-45672-I, E-45673-I…

Il database aziendale non forniva risposte esaustive, ma forse il computer del Capo Sezione non gli avrebbe mentito. Così, durante una delle innumerevoli notti insonni trascorse a betatestare il mostro informatico dai mille volti, il Dottor “E” fece una visitina non autorizzata nell’ufficio del Capo Sezione. Conosceva la scarsa fantasia del soggetto e avrebbe scovato la password del suo personal computer in un batter d’occhio.

– Il fesso avrà messo sicuramente il nome della figlia! – ma cliccando su “invio” si accorse che il tizio, forse, aveva preso lezioni serali di furbizia e quindi avrebbe dovuto riprovare chissà per quante ore prima di beccare la password giusta.

– Dai, dimmi quale è la password: non hai una vita interessante! Sei monotono come il ticchettio di un orologio a corda… Sei noioso come una sinfonia di Berlioz… Sei prevedibile come la mia sveglia delle 7… Quale cacchio di password avrà mai potuto partorire la tua mente ammuffita? Rilancio con il nome di tua moglie, dal momento che la nomini trecento volte al giorno. Ma non può essere così facile! – invece lo era. – Confermo: sei un fesso!

La cartella intitolata “Sion 2” era come uno scrigno ricolmo di dolorose sorprese e finalmente, nel suo notturno curiosare a caccia di prove in grado di confermare i suoi striscianti sospetti, quel codice cifrato comparve seguito da una esaustiva legenda – Eccolo! E-xxxxx-I… – l’aveva trovato. Poi continuò a visionare stupefatto la spiegazione delle lettere e dei numeri che lo componevano – Dove “E” sta per (manco a dirlo!) Eugenetica, xxxxx è il numero ordinario dei campioni risultati “positivi” e “I” sta per… – fece una pausa durante la quale sentì il proprio cuore saltargli in gola come in preda a una sorta di danza ritmica – … sta per “Israelita”.

– Ma che c’azzecca con l’alcol e la droga? Quale interazione può esserci con delle normali analisi del sangue? – continuava imperterrito a tergiversare ingenuamente mentre la scottante realtà dei fatti gli tirava il camice da laboratorio come per dire “ehi, sono qui!”

Rielaborando le sconvolgenti scoperte durante le settimane successive, il Dottor “E” raggiunse finalmente quella serenità che deriva dalla totale, seppur dolorosa, presa di coscienza di uno stato di cose che avrebbe potuto definire fantascientifiche, ma che rappresentavano, invece, la realtà per cui aveva inconsapevolmente lavorato in quegli ultimi anni.

– Perché individuare proprio quella precisa traccia genica? – aveva continuato a indagare tra le possibili applicazioni di “Sion 2” – Perché evidenziare l’eredità genetica israelita negli esseri umani del terzo millennio?

Lentamente il disegno malvagio di selezione genetica insito nell'”innocuo” programma informatico, stava prendendo forma nella mente incredula e interrogativa del Dottor “E”.

“Sion 2” avrebbe dovuto completare su scala mondiale l’interrotta “Soluzione Finale” ideata dai nazisti di Hitler durante il cosiddetto “secolo breve”: estirpare dal DNA dell’Umanità ogni ombra sionista capace di minare la tanto agognata resurrezione della stirpe ariana.

Non più rastrellamenti, fucilazioni, ghettizzazioni, forni crematori, fosse comuni o improponibili campi di concentramento dove stipare i “pezzi” in attesa di macabre docce a base di Zyklon B; non più treni della morte e improbabili partiti nazionalsocialisti che sarebbero stati sbarazzati sul nascere da un’opinione pubblica assopita, è vero, dalla tecnologia e dalle nuove droghe mediatiche, ma ancora resa memore dall’immane quantità di dati e di immagini ereditate dalla terribile esperienza storica della Shoah.

“Sion 2” rappresentava la silenziosa e globalizzata ripresa di un discorso interrotto dalle mire espansionistiche di sovietici e americani, che intervennero durante la seconda guerra mondiale non certamente per motivi umanitari, ma per allargare, ognuno a modo proprio e seguendo una personale tempistica, i propri orizzonti ideologici e, non ultimi, commerciali.

Il muro di Berlino e la Guerra Fredda ne furono le prove più evidenti.

Stavolta no. L’epurazione sociale avrebbe sfruttato le normali e legali vie della competizione aziendale; il curriculum lavorativo di un soggetto sarebbe stato condizionato dai risultati delle analisi di “Sion 2”; il pestifero popolo israelita, ancora presente e perfettamente diluito tra le genti di tutto il mondo, sarebbe stato selezionato e messo al muro non grazie all’eliminazione fisica, come era accaduto in passato, ma utilizzando un’indolore e quasi impercettibile selezione socio-economica. Banditi dalle aziende, dai posti di lavoro, dalle cariche pubbliche, dalle responsabilità civili che rendono un soggetto umano indispensabile e utile… Tutto questo senza mai nominare la parola “israelita”.

Il trucco? Attribuire a quel codice cifrato una qualsiasi inventata malattia genetica irreversibile, una malsana predisposizione all’alcol e alla droga, un riconosciuto impulso all’omicidio, una dannosa aspirazione al suicidio. Una plausibile causa di licenziamento o di mancata assunzione. Tutte notizie personali false e non diffusibili, ma che l’Organizzazione Mondiale della Sanità, i Ministeri della Sanità delle varie nazioni e le numerose aziende del pianeta avrebbero senz’altro apprezzato, ufficiosamente, in termini di previsioni capaci di evitare fastidiose perdite di risorse umane e dispendiose cure da caricare sui bilanci assicurativi.

Isolare e distruggere socio-economicamente un’intera razza e le sue diramazioni genetiche: questo era lo scopo di “Sion 2”.

ATCGTAAGATCGATAGTCGATTAGCTGATCGATGCTAGCATTATGCTAGTA

CTAGCGACGACGATGCTAGCTAGCTAGCTGACTGGTGTCGTAGCTGATCG

GTGTATGAGAGATTTATTTCCCGCGAGTCAGTCAGTCAGTACGTCTGCTAG

TCTGACTACTGCTGCAGTCAGACTGCATGCTGCAGTCTGCATGATCAGCT

AGCTGACTGACTGCAGTCAGTCGCAGCGAGGGAGAAATTCTTCCTCTCCC

TAGCAGCTAGTGGCTGACGTAGCTAGCTGATGCTAGCTGATCGTAGCTGA

TCGATCGTAGCATGCTAGCTAGCGACGAGCTAGCTAGCTGATCGAGCTAG

CTGATCGATGCTAGCTAGCTAGCTGACTGACGATGCTAGCTAGCTAGCTA

GCTAGCTAGCTAGCGATCGATGCTAGCTAGCTAGCTGACTGATCGATGCT

AGCTAGCTAGCTGACTGATGCATGCTAGCTAGCTAGCTAGCTAGCTGACT

GATCGATGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTGATCGATCGATG

CTAGCTAGCTAGCTAGCTGATCGATGCTAGCTAGCTAGCTGACTAGCTGA

TCGATCGATGCTAGCTAGCTATAGCAGCAGCTAGCTAGCATGCTAGCATG

Gli antichi “mattoncini” del DNA messi al servizio, nuovamente, di una rediviva eugenetica nazista tecnologicamente avanzata. I subdoli obiettivi dei Savi di Sion sarebbero stati sbaragliati ancora una volta e il grande complotto sionista ai danni del mondo ariano non avrebbe visto, mai più, una nuova alba.

Advertisements

Rispondi

Inserisci i tuoi dati qui sotto o clicca su un'icona per effettuare l'accesso:

Logo WordPress.com

Stai commentando usando il tuo account WordPress.com. Chiudi sessione / Modifica )

Foto Twitter

Stai commentando usando il tuo account Twitter. Chiudi sessione / Modifica )

Foto di Facebook

Stai commentando usando il tuo account Facebook. Chiudi sessione / Modifica )

Google+ photo

Stai commentando usando il tuo account Google+. Chiudi sessione / Modifica )

Connessione a %s...

%d blogger hanno fatto clic su Mi Piace per questo: