Archivio per eugenetica

The Giver – Il mondo di Jonas

Posted in nigrologia with tags , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , on 11 aprile 2017 by Michele Nigro

versione pdf: The Giver – Il mondo di Jonas

Una delle caratteristiche più frequenti nei recenti film di genere fantascientifico è senza alcun dubbio il processo di ibridazione da cui nascono: l’originalità, sempre più rara, è stata sostituita da più sicuri incroci tra porzioni di precedenti pellicole di successo (anche di generi differenti), come in una sorta di grande esperimento di ingegneria genetica adattata alla cinematografia. Lungi da me il voler giudicare come negativa questa tecnica d’ibridazione, che nella maggior parte dei casi fornisce risultati gradevoli, sarebbe tuttavia interessante analizzarne – in altra sede e in maniera più approfondita – l’origine, gli obiettivi, le tecniche narrative che utilizza per rendere credibile il risultato finale: si tratta di mancanza di idee come accennavo all’inizio? Voglia di “contaminazione” tra generi? Sperimentalismo transmediale libro-film? Sta di fatto che questi film derivano quasi sempre da altrettanti romanzi, quindi l’ibridazione avviene a monte. È letteraria.

Non sfugge a tale fenomenologia il film intitolato The Giver – Il mondo di Jonas (tratto dal romanzo The Giver – Il donatore di Lois Lowry): l’accostamento più facile da fare sarebbe quello con il film Hunger Games, ma scavando in profondità è interessante rilevare quante altre analogie meritano di essere scoperte e analizzate. La storia contenuta nel film di Phillip Noyce ha letteralmente “rubato” l’idea della riscoperta dei colori (e delle emozioni) a un altro grande film sottovalutato: Pleasantville. L’assegnazione di mansioni al compimento del 18° anno d’età assomiglia alla divisione in fazioni presente nel romanzo Divergent di Veronica Roth (dal momento che il romanzo della Roth è del 2011, mentre quello di Lowry è del 1993, sarebbe il film Divergent ad avere un “debito” con The Giver – Il mondo di Jonas; anche se entrambi i film sono del 2014!). L’estirpazione delle emozioni dall’animo umano è un chiaro riferimento al film Equilibrium di Kurt Wimmer; la società quasi apatica, senza classi e senza memoria di The Giver ricorda un po’ quella degli Eloi di H. G. Wells; l’iniezione mattutina per debellare gli impulsi sessuali e sentimentali è l’equivalente, in termini di controllo sociale, dell’assunzione di soma ne Il mondo nuovo di Aldous Huxley; l’amore controllato (e inibito) tra uomo e donna non può non rievocare il rapporto proibito tra Winston e Julia nel celebre romanzo 1984 di George Orwell. Per non parlare della deriva eugenetica, presente in numerose opere letterarie e cinematografiche fantascientifiche. Interessante il riferimento antiabortista (i bambini non conformi allo standard vengono “congedati”: un modo pulito per dire uccisi) e quindi antispartano contenuto nel messaggio filmico. Riferimento che potrebbe essere esteso anche al tema delicato e attuale dell’eutanasia: quando una società legifera sulla nascita, sulla morte e sui sentimenti ed emozioni contenuti nell’intervallo di tempo compreso tra questi due momenti, può definirsi libera? Sembrerebbe chiedersi la voce narrante di questa storia. Anche se, come accade nella realtà, non è la condizione esistenziale in sé ma la necessaria presa di coscienza a fare la differenza in termini di azioni da intraprendere.

L’idea di una società distopica “con il trucco” non è originalissima: nella maggior parte dei casi si tratta di società post-apocalittiche, perché deve esserci sempre un evento passato sconvolgente – una guerra, un’epidemia, una quasi estinzione – per far cambiare rotta all’umanità e per farle scegliere un nuovo inizio basato su scelte radicali applicate da un’oligarchia. Come a voler dire: “abbiamo sbagliato, è vero, ma da oggi in poi si riga dritto, con nuove regole e guai a chi sgarra!” Innumerevoli sono gli esempi, fantascientifici e non, letterari e cinematografici, di società apparentemente perfette ma che nascondono regole di vita disumane e innaturali: The Island film di Michael Bay, L’uomo che fuggì dal futuro (THX 1138) di George Lucas, La penultima verità (The Penultimate Truth) romanzo di Philip K. Dick, The Truman Show film di Peter Weir, La fuga di Logan (Logan’s Run) film di Michael Anderson, La possibilità di un’isola romanzo di Michel Houellebecq… ecc. Continuate voi: sono sicuro che avete almeno un titolo di film o di romanzo da aggiungere all’elenco!

Continua a leggere

Annunci

Le sabotage

Posted in nigrologia with tags , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , on 22 gennaio 2015 by Michele Nigro

1901941_735952803141875_8762058036652972645_n

Si attende il virgulto ereditante

agognato sospiro di tesi parenti

sospettosi, insinuanti

in astinenza da gioie altrui.

Sciocca salvezza genetica

rispettata tradizione da mostrare

su balconi annuncianti e gloriosi

di familiari dittature, bassa cultura

dello sperma arruolato da morenti zie

per secolari guerre di posizione.

Alberi genealogici bruciati

dal fuoco di un’indifferente

attesa goliardica,

osservi ciondolare i tuoi piedi

da un ponte sul Bosforo, eterno fanciullo curioso

ti unisci in matrimonio con il mondo.

La discendenza sarà un puzzle ribelle

di esperienze e parole

senza copie casuali da allattare,

diventerai l’improduttivo sabot

tra gli ingranaggi di un sorridente sistemarsi

che detta leggi e tempi.

Testamento a te stesso,

ti allontani lento da maschere sociali

assetate di finta stabilità, premessa di una morte in vita

non ascolti dicerie

non assecondi profezie.

Libera e consapevole riproduzione di idee

eredità pensata, lontana dal clamore

nella rassegnata dimenticanza

degli etichettatori di quantità sessuali.

Morirete con me

inutili aratri, storici solchi abusati

nel dolce tramonto dell’esistenza.

Arturo Toscanini e Wernher von Braun

Posted in nigrologia with tags , , , , , , , , , , , , , , , , , , , on 3 novembre 2012 by Michele Nigro

Dov’è il microchip?

Non appena l’ologramma del maestro Toscanini posò la bacchetta da direzione sul leggio tra gli applausi del pubblico, l’olomusic si spense automaticamente facendo sparire nel nulla la Carnegie Hall di New York, e i pensieri della Rossa ripiombarono nel baratro psicologico creato dai fatti accaduti in chiesa poche ore prima. Vi sono momenti, nella vita di un individuo, durante i quali il cervello si rifiuta di affrontare immediatamente i guai che si presentano lungo il cammino e così se ne va in giro alla ricerca automatica e casuale di una soluzione, vagando nel buio, a volte guidato dal suono, con la speranza di avvistare una luce lontana, una casa accogliente per la mente, un fuoco amico scoppiettante di fortuite verità salvifiche. La musica classica eseguita dal direttore schiaffeggiato dal fascismo, però, non l’aveva aiutata.

Era vero. Pur di proteggere il programma, il Servo aveva sacrificato la vita di suo padre, il Dottor “E”, creatore del programma di eugenetica elaborato dalla FutureProg per coadiuvare segretamente esperimenti di purezza ariana. I neonazisti del Terzo Millennio ci si gingillavano da alcuni anni con grandi investimenti, provocando rigurgiti pseudoscientifici di una delle più scellerate pagine della storia umana del XX secolo, da molti pericolosamente archiviata.

Non era certamente un caso che fosse proprio la TecnoMafia berlinese a occuparsi del recupero di quel maledetto programma, già macchiato di sangue, e senza essere mai stato usato.

La morte del Dottor “E” era stata la giusta punizione per chi collabora consapevolmente a un progetto diabolico, oppure era la normale uscita di scena di un’ingenua e sfruttata pedina divenuta poco importante? Non era necessario, a questo punto, saperlo.

Ciò che di tanto in tanto la risvegliava dall’oblio in cui era immersa fin dal suo ritorno dalla Cattedrale degli Apostoli fu la rabbia nei confronti del Servo, causata dalla facilità con cui quest’ultimo aveva, a suo modo, risolto il problema della loro protezione.

Non aveva bisogno di balie, lei. Sapeva badare a se stessa… nonostante la presenza minacciosa di mafiosi teutonici che le davano la caccia.

I due uomini entrati in chiesa, mentre si “confessava” con il don Abbondio di questa strana guerra tecnologica fatta a suon di dischetti ultracapienti e pen drive organiche, non erano (per sua fortuna!) dei berlinesi, ma due agenti dei Servizi Segreti di Sua Maestà Carlo d’Inghilterra, il real coglione ormai invecchiato, e tenuto in piedi da costose e sofisticate biotecnologie anti-age Made in England, che aveva combinato altri casini imperiali nel secolo passato, alimentando lo sporco lavoro dei tabloid del suo Paese. Gli stessi Servizi Segreti che a suo tempo deviarono magistralmente le indagini di Scotland Yard sul coinvolgimento di Buckingham Palace nella morte di Lady D.

– Non si sono certamente precipitati per salvaguardare la mia incolumità! – aveva quasi gridato la Rossa non appena li vide entrare in chiesa, mentre il Servo cercava di calmarla spiegandole che era per il suo bene.

– Ma perchè sei così ingenuo? – la Rossa lo aveva etichettato senza pietà nel momento in cui già stava per uscire dal confessionale, dirigendosi verso i due individui con in faccia il sorriso di chi vede gli angeli custodi mandati da Dio – Non lo sai che americani e inglesi fanno questo fin dalla fine degli anni 40 del secolo scorso? – riprese fiato – Con la scusa di proteggere e prevenire, di esportare democrazia, si impossessano delle scoperte altrui e trasformano le idee malvagie dei dittatori in “bene comune”… Secondo te come sono andati sulla Luna e come hanno fabbricato le bombe atomiche lanciate su Hiroshima e Nagasaki? Berlinesi e inglesi: stessa inculatura, ma in lingue diverse!

Sì, avevano bisogno di una donna, stavolta avevano bisogno della Rossa. O meglio: avevano bisogno del programma. Lo avrebbero ripulito dalla sua vergognosa patina razzista riciclandolo sulle edulcorate vie del liberismo economico: eugenetica aziendale e commerciale.

Ma lei l’aveva nascosto molto bene. E poi ci sarebbe stato bisogno della password alfaideogrammatica inventata da suo padre, per aprirlo e renderlo operativo.

Non poteva dimenticare la faccia attonita dei due “setter inglesi” mentre la videro risalire sulla Ducati e soprattutto il ghigno nervoso di uno dei due quando lei si lasciò sfuggire con aria beffarda, prima di chiudere la visiera del casco – … non lo avrete mai!

– Ah! Servo, Servo, fratello mio: solo il prete potevi fare, fesso come sei. – ritornò a pensare la Rossa abbracciata dalla calda accoglienza della sua stanza. La malizia di questo suo ultimo pensiero rappresentava il segno di un rinnovato vigore morale e la tanto attesa uscita dall’oblio del dopo Toscanini. Forse, nonostante la confusione di quelle ultime ore, aveva ancora la situazione in pugno.

– Mio padre: un pazzo? Un ingenuo? Chissà. – sussurrò la Rossa mentre continuava ad accarezzarsi il braccio – Però che genialata nascondere il microchip con la password sotto il mio tatuaggio!

“La mano servita” di Robert J. Sawyer su Kipple.it

Posted in nigrologia with tags , , , , , , , , , , , , , , , , , , , , , , , , on 26 luglio 2012 by Michele Nigro

Esce per i tipi elettronici della Kipple Officina Libraria il racconto inedito “La mano servita” di Robert J. Sawyer, finalista al Premio Hugo.

Acquistabile qui!

Robert J. Sawyer

 La mano servita

 racconto

titolo originale: The Hand You’re Dealt
traduzione a cura di Francesco Verso
revisione di Sally McCorry
copertina: Lorenzo Nuti
Collana: eAvatar
Editore: Kipple Officina Libraria, luglio 2012
http://www.kipple.it
Formato: ePub – Mobipocket

Futuro, in qualche parte dell’universo. Nella città modulare di Mendelia la divinazione eseguita sul DNA dei cittadini è una pratica obbligatoria. Che storia si nasconde dietro l’uccisione di un indovino? Toby Korsakov, della Polizioteca, indaga fino a una sconvolgente “verità genetica”. Nanotecnologia, bioetica, ingegneria genetica: nel racconto di Sawyer tutti gli elementi per una intelligente discussione multidisciplinare, riguardante anche l’umanità del presente, sono magistralmente intrecciati in una vicenda poliziesca breve ma intensa.

 <<… Seppure sia possibile raccontare tutto ciò che è scritto nel DNA, non ci si può fare un bel niente. Qui, su Mendelia, si gioca la mano che viene servita.>>

Robert James Sawyer (Ottawa, 29 aprile 1960) è un autore di fantascienza canadese. Si definisce uno scrittore di fantascienza hard, ma di fatto il suo interesse per la caratterizzazione e la psicologia dei personaggi è molto superiore a quello tipico del sottogenere. Le sue opere hanno spesso connotazioni metafisiche, alla Arthur C. Clarke; appartiene in pieno alla scuola secondo cui la fantascienza è letteratura di idee. Per le sue opere ha vinto trentacinque premi nazionali e internazionali, tra cui in particolare il premio Nebula del 1995 per il suo romanzo Killer on-line (The Terminal Experiment), e il premio Hugo del 2003 per il romanzo La genesi della specie (Hominidis). I racconti di Sawyer sono apparsi su Analog Science Fiction, Amazing Stories, On Spec, e numerose antologie. Dal suo romanzo Avanti nel tempo è stato ideato il serial televisivo FlashForward.

Vincitore del Premio Science Fiction Chronicle assegnato dai lettori – 1998
Finalista al Premio Hugo nella categoria racconto breve – 1998
Finalista al Premio Aurora nella categoria miglior racconto breve in lingua inglese – 1998
Finalista al Premio Arthur Ellis nella categoria racconto breve – 1998

From Robert J. Sawyer, author of the TV series FlashForward.

Future. Somewhere in the universe. In the modular city of Mendelia, divination – performed on citizen’s DNA – is a mandatory practice. But what mistery lies behind the killing of a soothsayer? Toby Korsakov, of the Cop Shop, investigates on the case up to the discovery of a shocking “genetic truth.”
Nanotechnology, bioethics, genetic engineering: the story of Robert J. Sawyer weaves all the elements for a sharp multidisciplinary discussion, regarding the present of humanity, in a skillful way and into a detective story, which is short but intense.

Robert James Sawyer (Ottawa, April 29, 1960) is a Canadian Science Fiction author.
He considers himself a “hard” SF writer, but his interests in psychological characterization and portrait are much higher than the typical subgenre ones. His works have often metaphysical connotations, like Arthur C. Clarke and he sits firmly in the school that considers Science Fiction as a literature of ideas. His works obtained thirty-five national and international Awards, including the Nebula Award in 1995 for “The Terminal Experiment” and the Hugo Award in 2003 for “Hominids”. Sawyer’s stories have appeared in Analog Science Fiction, Amazing Stories, On Spec, and numerous other anthologies.
From his novel Flash Forward was created the 2009 TV series.

Winner Science Fiction Chronicle Reader Award for Best Short Story of the Year
Finalist Hugo Award for Best Short Story of the Year
Finalist Aurora Award for Best English-Language Short Story of the Year
Finalist Arthur Ellis Award for Best Short Story of the Year

L’evoluzione della morte

Posted in nigrologia with tags , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , on 1 dicembre 2011 by Michele Nigro

Suicidio, evoluzione, postumanesimo  

 
<<…Chi l’ha detto che il cancro è più doloroso della solitudine e della depressione? Io non l’ho mai pensato. Esco dalla chiesa facendomi la santa croce, e rivolgendomi al Cristo in croce che troneggia dall’abside mi lascio scappare un: «…mi affido a Te!». Blasfemo? Dipende dai punti di vista.
C’è una donna delusa dalla vita che m’aspetta: quattro figli finiti male, un divorzio alle spalle e l’alcolismo che non la molla. Il coraggio per farla finita non ce l’ha: allora entro in campo io. Stasera le porto il suo “biglietto aereo”. Agisco senza lasciare tracce; tutto secondo i piani; da vero professionista. Il luogo all’aperto ma isolato lo ha scelto lei: non vuole farsi trovare in casa morta. L’arma la scelgo sempre io: è la stessa che uso per ogni caso del nuovo filone. Più rapida della flebo… questo è sicuro.
Il silenziatore applicato alla pistola nascosta nel cappotto e vado all’appuntamento. Ha smesso di piovere. Vado mezz’ora prima per esaminare il luogo e per assicurarmi che non ci siano sbirri nascosti o troupe televisive appostate e pronte a immortalarmi nel caso in cui la disperata, non più depressa, abbia deciso di essere più affarista di me. Tutto libero: il contatto è serio. Mi avvicino, la riconosco: è la stessa della foto mandata via e-mail; per sicurezza le chiedo il nome e il cognome: è proprio lei. La saluto cordialmente come se fossimo in una sala da tè e lei, invece, mi chiede subito: «Si parte?» Le sorrido come per dire sì.
Estraggo l’arma e la punto verso il volto di una persona morta da tempo: almeno interiormente. Non ho bisogno di prendere un respiro profondo: la pressione del mio dito e il pensiero della morte sono saldati in un unico corpo metallico rovente raffreddato solo dall’eternità di quel momento. Un colpo, niente di più: sono preciso, impeccabile e geometrico nei miei gesti. Sono un’opera d’arte dinamica votata alla morte: a volte mi adoro. I soldi sono diventati quasi un particolare, a dire il vero. Il mio, ormai, non è più un lavoro: è una missione.
Aiuto gli altri a non soffrire più…non importa quale sia il male. E questa rivalsa sul dolore, vi confesso, mi inebria.>>
 

Lo stralcio con cui ho voluto cominciare questo post è tratto da un mio vecchio racconto intitolato “Il missionario” (pubblicato su “Micropulp” n.2) riguardante un tema drammatico, quello dell’eutanasia, che periodicamente torna in auge soprattutto grazie a casi eclatanti di cronaca capaci però di riaccendere soprattutto la discussione intorno ai suoi aspetti ideologico-politici tralasciando quelli umani e spirituali ben più importanti. La libertà insita nell’invenzione narrativa mi diede all’epoca della stesura l’opportunità di pensare a un personaggio noir esagerato e per nostra fortuna inesistente, un “professionista della morte”. Uno che per mestiere aiuta i malati terminali a compiere il passaggio estremo operando in maniera attiva e sostituendosi agli interessati nell’ultima fase della loro vita: una tragica figura professionale, volutamente marcata e utilizzata nel mio racconto con finalità provocatorie, da non confondere con quella reale e attuale del medico che si occupa di suicidio assistito, ovvero di un professionista che, dopo aver scrupolosamente valutato insieme al paziente tutte le possibili alternative al suicidio, ha il delicato compito di predisporre le condizioni medico-tecniche grazie alle quali il paziente compie autonomamente il passo finale, ingerendo il farmaco letale (o utilizzando altri metodi di somministrazione scelti caso per caso) fornitogli dal suddetto assistente che non interviene in maniera attiva ma è lì per accertarsi dell’avvenuto decesso (vedi anche suicidio assistito).

Nella parte finale della mia finzione narrativa l’assistenzialismo del personaggio subisce tuttavia una ‘profetica’ evoluzione: a essere interessati alla sua proposta professionale non sono solo i malati di cancro o di altre malattie fisiche degenerative e irrevocabili, bensì anche i malati nell’anima, i depressi.

Il recente caso di Lucio Magri ha riaperto la discussione tra i soliti guelfi e ghibellini della politica italiana sull’eutanasia ma l’ha riaperta questa volta su uno scenario diverso: Magri non era un malato terminale di cancro, non aveva metastasi disseminate nel proprio corpo, non soffriva di una malattia che gli stava lentamente corrodendo gli organi e che lo avrebbe portato a una morte certa. Lucio Magri era depresso: e non è poco, dal momento che la depressione può dare luogo a gravi ripercussioni fisiche, anche se non mortali. Non è poco, ma non basta. E il perché di questa ‘insufficienza di prove’ è presto dimostrata. Nonostante gli sviluppi compiuti dalla scienza sulla conoscenza del funzionamento del sistema nervoso e delle patologie che lo riguardano, siamo costretti ad ammettere che la ‘sede organica della mente’, il cervello, rappresenta per noi ancora un grande mistero (di tipo scientifico e da un punto di vista ‘aristotelico’ anche un mistero metafisico). La neurofarmacologia ha fatto passi da gigante e ha fornito ai sofferenti di depressione dei validi strumenti chimici per vivere una vita dignitosa. Anche se la chimica da sola non basta: per lottare contro la depressione e per migliorare la qualità della vita del paziente occorre un approccio psicoterapeutico mirato.

Partendo da tale premessa è lecito porsi la domanda se sia giusto applicare le stesse regole del suicidio assistito anche alla malattia chiamata depressione. Qualcuno se l’è posta questa domanda e le argomentazioni addotte sono convincenti quasi come quelle (se non di più) presentate dal paziente che chiede di ‘andarsene’ da questo mondo in quanto depresso.

Giunti al nostro incrocio troviamo, tra le altre, le strade della libertà individuale, della scelta privata. Di quello che usiamo definire libero arbitrio. Sarebbe limitativo e poco intelligente liquidare la questione dell’eutanasia in generale, e del suicidio assistito applicato ai malati psichici in particolare, riproponendo gli alibi dello stato sovrano che decide sulla vita e sulla morte dei cittadini o del determinismo religioso (della serie: “Non si fa perché è peccato! Perché bisogna seguire il proprio destino!” oppure “Non puoi suicidarti perché la tua sofferenza fa parte di un progetto superiore incomprensibile e quindi devi accettarla come un dono!”).

C’è bisogno di nuove risposte (né ideologico-politiche, né dogmatico-religiose) capaci di captare i mutamenti evoluzionistici del concetto di morte e indipendentemente dal proprio credo religioso dobbiamo essere in grado di porci la seguente domanda: “Che valore ha oggi per noi la vita?”

Il mio racconto conteneva un quesito allarmistico riguardante il possibile abuso del suicidio assistito (attivo o passivo): cosa succederà in futuro se una errata interpretazione della ‘dolce morte’ lancerà una nuova moda facilona e gli esseri umani cominceranno a valutare le varie tecniche per abbandonare questa vita, messe a disposizione dal ‘mercato’, come se si stesse parlando di scegliere tra i vari modelli di automobile più convenienti? Sceglieremo il modo di andarcene come se scegliessimo le piastrelle per il bagno e la carta da parati? Se oggi anche i depressi possono accedere al suicidio assistito, quale sarà domani la soglia critica dell’imperfezione sopportabile superata la quale poter decidere di farla finita? Il problema riguardante la soglia non è “chi la deciderà?” (se lo Stato o la Chiesa: dal momento che, a quanto sembra, basta varcare i confini della propria nazione e staccare un paio di assegni per risolvere il problema) ma la domanda giusta è “saremo in grado, a livello personale e privato, di decidere saggiamente? avremo gli strumenti mentali, culturali, spirituali, scientifici per affrontare in maniera equilibrata quella che dovrebbe essere l’ultima e la più importante decisione della nostra vita?” E ancora: “quale sarà la scala di valori che ci guiderà verso questa decisione? Il disagio e il dolore troveranno terreno fertile per autogiustificarsi grazie a un consumismo della morte che renderà tutto più facile? Le agevoli vie d’uscita eutanasiche e suicidarie prevalranno sulla ricerca attiva di una soluzione umana?” Qualcuno potrebbe rispondere a tutte queste domande affermando che chi decide di suicidarsi non conosce ostacoli e a volte mette in pericolo anche la vita degli altri con gesti spettacolari e distruttivi. Tuttavia fornire una via d’uscita ‘pulita’ può essere allo stesso modo mostruoso. Da qui all’eugenetica il passo è breve.

Nel film di fantascienza sociologica intitolato 2022: i sopravvissuti (titolo originale: Soylent Green; tratto dal romanzo di Harry Harrison “Largo! Largo!”) è descritta una società futura in cui il suicidio assistito non solo è legalizzato ma addirittura incentivato e curato con metodo industriale a causa del sovraffollamento che affligge l’umanità del 2022: si scoprirà in seguito che i corpi dei morti naturali e dei suicidi volontari serviranno a produrre l’alimento più diffuso tra la popolazione, il Soylent Green. La morte diventa così un evento proficuo, un affare, un momento di pubblica utilità.

I fautori del suicidio assistito, nei paesi dove è legale, hanno fatto di tutto per regolamentare la loro filosofia di fine vita, così come dimostra la brochure dell’associazione svizzera “Dignitas” che si occupa di suicidio assistito con lo stesso ‘entusiasmo turistico’ e la stessa dedizione teutonica del personaggio che agisce nel mio racconto. Dalla fantasia della scrittura alla realtà quotidiana.

Chi può assicurarci che, nonostante l’attuale dovizia di regolamentazioni, un giorno non si allenteranno i ‘freni inibitori’ della legislazione suicidaria per assecondare motivi insondabili così come accade, anche se in maniera fantascientifica, nel film sopra citato? O meglio: al di là delle motivazioni alimentari, sociali ed economiche, tirate in ballo a livello cinematografico, non si potrebbe pensare molto più realisticamente a una, non lontana nel tempo e già in atto, svalutazione dell’esistenza umana? Il suicidio assistito come la rottamazione dell’auto usata.

Continua a leggere

L’eugenetica del Dottor E

Posted in nigrologia with tags , , , , , , , , , , , , , , , , , , , , on 29 aprile 2010 by Michele Nigro

Prequel n.2

“L’eugenetica del Dottor E”

Nei laboratori della FutureProg.

Qualche anno prima della grande caccia al programma.

Mentre tamburellava con la matita sui raccoglitori accumulati nello scaffale e ripieni di analisi di laboratorio effettuate in quei duri anni di lavoro e di campionatura, il Dottor “E”, così l’avevano ribattezzato i suoi più stretti collaboratori lì alla FutureProg, non poté fare a meno di rimuginare sugli imprevisti e a dir poco sconvolgenti risultati segreti del beta testing di “Sion 2”.

Un nome biblico per un programma che avrebbe dovuto gestire il lavoro complesso e delicato dei tanti laboratori di analisi cliniche sparsi nel mondo e messi in rete. Se gli affari fossero andati come aveva previsto il fiducioso amministratore delegato direttamente piombato dalla sede centrale per assistere ai primi vagiti dell’applicazione – … il mondo non sarebbe stato più lo stesso… – queste le esagerate e ottimistiche parole usate dal pezzo grosso durante un’innocua pausa caffé. Parole a cui non aveva mai dato o non aveva mai potuto dare, in quanto reso inoffensivo dalla mancanza di dati più “intimi”, la giusta importanza.

– Chissà perché un nome biblico – continuava a chiedersi il Dottor “E”. Forse per impressionare gli informatori impegnati nei loro giri danteschi alla ricerca di possibili acquirenti o forse per impressionare gli stessi acquirenti, compresi i politici impegnati nella complessa gestione sanitaria dei paesi rappresentati, facendo leva sulla loro reverenziale coscienza religiosa collettiva ben nascosta tra le pieghe più arcaiche del cervello.

Ora, però, conosceva il vero perché di quel nome. Ma era troppo tardi. O forse no…

Dunque, i contagiosi “Protocolli dei Savi Anziani di Sion” avevano finalmente trovato la loro terapia globale in quel programma informatico capace di gestire, tramite la Rete, i dati di migliaia di laboratori sparsi nel mondo, in barba alle più elementari leggi sulla privacy con cui i politici si facevano belli dinnanzi alle telecamere e agli elettori.

Dopo l’eclatante fallimento nazista del secolo scorso e la storica diluizione degli sforzi eugenetici in tanti piccoli rivoli insignificanti, presto dimenticati, la subdola risposta all’oltraggiosa fondazione dello Stato di Israele si era trasformata con il tempo in uno dei progetti più capillari della storia umana. Chi, almeno una volta durante la propria vita e per i motivi più disparati, non aveva avuto bisogno di compiere delle semplici e routinarie analisi del sangue o non aveva depositato la propria saliva per un semplice test infettivistico? Tutti… Già, proprio tutti. Prassi quasi quotidiana nell’allarmistica e ben curata società del terzo millennio. Almeno in quella ricca, quella che conta dal punto di vista economico e tecnologico.

– Che ingenuo, sono stato! – pensava il rinsavito Dottor “E” mentre ripercorreva mentalmente le fasi più importanti dell’elaborazione del “Pacchetto Sion 2”. Non solo gestione dei dati in Rete, dunque, ma anche ricerca eugenetica camuffata da propositi umanistici e di ordine pubblico – L’Organizzazione Mondiale della Sanità ci ha chiesto espressamente di compiere una ricerca su vasta scala, tramite “Sion 2”, di quei fattori genetici che predisporrebbero gli individui all’uso di droghe e alcol… per bloccare l’impressionante parabola di omicidi, suicidi, incidenti stradali e sul lavoro, in tutto il mondo… – gli avevano detto alla vigilia del beta testing.

– Dottor “E”… “E” come Eugenetica! – rise amaramente – Dunque i miei più stretti collaboratori, i miei “amici” qui alla FutureProg, sapevano e sanno?

Ora tutte le tessere di quel mosaico invisibile ma reale si stavano riordinando pian piano nella sua sconvolta psiche di essere umano deluso e sfruttato. “Sion 2” avrebbe dovuto funzionare pressappoco così: il programma che gestiva il computer interno agli analizzatori, oltre a svolgere le sue normali e banali funzioni sequenziali, sarebbe stato in grado, parallelamente, di compiere una precisa e non autorizzata ricerca genetica sui campioni di sangue giunti in laboratorio. Una ricerca capace di stanare, negli anfratti cromosomiali delle cellule sanguigne, le più insignificanti tracce genomiche israelite tramandate nel tempo e insabbiate dai naturali incroci che la moderna e libera società globalizzata rendeva possibile ormai da decenni ai suoi inconsapevoli figli da redimere.

Tutto era cominciato alcune settimane prima.

Durante le fasi finali del beta testing, il Dottor “E” non riusciva a spiegarsi quella sigla cifrata che di tanto in tanto compariva al lato del numero di campione: … E-45671-I, E-45672-I, E-45673-I…

Il database aziendale non forniva risposte esaustive, ma forse il computer del Capo Sezione non gli avrebbe mentito. Così, durante una delle innumerevoli notti insonni trascorse a betatestare il mostro informatico dai mille volti, il Dottor “E” fece una visitina non autorizzata nell’ufficio del Capo Sezione. Conosceva la scarsa fantasia del soggetto e avrebbe scovato la password del suo personal computer in un batter d’occhio.

– Il fesso avrà messo sicuramente il nome della figlia! – ma cliccando su “invio” si accorse che il tizio, forse, aveva preso lezioni serali di furbizia e quindi avrebbe dovuto riprovare chissà per quante ore prima di beccare la password giusta.

– Dai, dimmi quale è la password: non hai una vita interessante! Sei monotono come il ticchettio di un orologio a corda… Sei noioso come una sinfonia di Berlioz… Sei prevedibile come la mia sveglia delle 7… Quale cacchio di password avrà mai potuto partorire la tua mente ammuffita? Rilancio con il nome di tua moglie, dal momento che la nomini trecento volte al giorno. Ma non può essere così facile! – invece lo era. – Confermo: sei un fesso!

La cartella intitolata “Sion 2” era come uno scrigno ricolmo di dolorose sorprese e finalmente, nel suo notturno curiosare a caccia di prove in grado di confermare i suoi striscianti sospetti, quel codice cifrato comparve seguito da una esaustiva legenda – Eccolo! E-xxxxx-I… – l’aveva trovato. Poi continuò a visionare stupefatto la spiegazione delle lettere e dei numeri che lo componevano – Dove “E” sta per (manco a dirlo!) Eugenetica, xxxxx è il numero ordinario dei campioni risultati “positivi” e “I” sta per… – fece una pausa durante la quale sentì il proprio cuore saltargli in gola come in preda a una sorta di danza ritmica – … sta per “Israelita”.

– Ma che c’azzecca con l’alcol e la droga? Quale interazione può esserci con delle normali analisi del sangue? – continuava imperterrito a tergiversare ingenuamente mentre la scottante realtà dei fatti gli tirava il camice da laboratorio come per dire “ehi, sono qui!”

Rielaborando le sconvolgenti scoperte durante le settimane successive, il Dottor “E” raggiunse finalmente quella serenità che deriva dalla totale, seppur dolorosa, presa di coscienza di uno stato di cose che avrebbe potuto definire fantascientifiche, ma che rappresentavano, invece, la realtà per cui aveva inconsapevolmente lavorato in quegli ultimi anni.

– Perché individuare proprio quella precisa traccia genica? – aveva continuato a indagare tra le possibili applicazioni di “Sion 2” – Perché evidenziare l’eredità genetica israelita negli esseri umani del terzo millennio?

Lentamente il disegno malvagio di selezione genetica insito nell'”innocuo” programma informatico, stava prendendo forma nella mente incredula e interrogativa del Dottor “E”.

“Sion 2” avrebbe dovuto completare su scala mondiale l’interrotta “Soluzione Finale” ideata dai nazisti di Hitler durante il cosiddetto “secolo breve”: estirpare dal DNA dell’Umanità ogni ombra sionista capace di minare la tanto agognata resurrezione della stirpe ariana.

Non più rastrellamenti, fucilazioni, ghettizzazioni, forni crematori, fosse comuni o improponibili campi di concentramento dove stipare i “pezzi” in attesa di macabre docce a base di Zyklon B; non più treni della morte e improbabili partiti nazionalsocialisti che sarebbero stati sbarazzati sul nascere da un’opinione pubblica assopita, è vero, dalla tecnologia e dalle nuove droghe mediatiche, ma ancora resa memore dall’immane quantità di dati e di immagini ereditate dalla terribile esperienza storica della Shoah.

“Sion 2” rappresentava la silenziosa e globalizzata ripresa di un discorso interrotto dalle mire espansionistiche di sovietici e americani, che intervennero durante la seconda guerra mondiale non certamente per motivi umanitari, ma per allargare, ognuno a modo proprio e seguendo una personale tempistica, i propri orizzonti ideologici e, non ultimi, commerciali.

Il muro di Berlino e la Guerra Fredda ne furono le prove più evidenti.

Stavolta no. L’epurazione sociale avrebbe sfruttato le normali e legali vie della competizione aziendale; il curriculum lavorativo di un soggetto sarebbe stato condizionato dai risultati delle analisi di “Sion 2”; il pestifero popolo israelita, ancora presente e perfettamente diluito tra le genti di tutto il mondo, sarebbe stato selezionato e messo al muro non grazie all’eliminazione fisica, come era accaduto in passato, ma utilizzando un’indolore e quasi impercettibile selezione socio-economica. Banditi dalle aziende, dai posti di lavoro, dalle cariche pubbliche, dalle responsabilità civili che rendono un soggetto umano indispensabile e utile… Tutto questo senza mai nominare la parola “israelita”.

Il trucco? Attribuire a quel codice cifrato una qualsiasi inventata malattia genetica irreversibile, una malsana predisposizione all’alcol e alla droga, un riconosciuto impulso all’omicidio, una dannosa aspirazione al suicidio. Una plausibile causa di licenziamento o di mancata assunzione. Tutte notizie personali false e non diffusibili, ma che l’Organizzazione Mondiale della Sanità, i Ministeri della Sanità delle varie nazioni e le numerose aziende del pianeta avrebbero senz’altro apprezzato, ufficiosamente, in termini di previsioni capaci di evitare fastidiose perdite di risorse umane e dispendiose cure da caricare sui bilanci assicurativi.

Isolare e distruggere socio-economicamente un’intera razza e le sue diramazioni genetiche: questo era lo scopo di “Sion 2”.

ATCGTAAGATCGATAGTCGATTAGCTGATCGATGCTAGCATTATGCTAGTA

CTAGCGACGACGATGCTAGCTAGCTAGCTGACTGGTGTCGTAGCTGATCG

GTGTATGAGAGATTTATTTCCCGCGAGTCAGTCAGTCAGTACGTCTGCTAG

TCTGACTACTGCTGCAGTCAGACTGCATGCTGCAGTCTGCATGATCAGCT

AGCTGACTGACTGCAGTCAGTCGCAGCGAGGGAGAAATTCTTCCTCTCCC

TAGCAGCTAGTGGCTGACGTAGCTAGCTGATGCTAGCTGATCGTAGCTGA

TCGATCGTAGCATGCTAGCTAGCGACGAGCTAGCTAGCTGATCGAGCTAG

CTGATCGATGCTAGCTAGCTAGCTGACTGACGATGCTAGCTAGCTAGCTA

GCTAGCTAGCTAGCGATCGATGCTAGCTAGCTAGCTGACTGATCGATGCT

AGCTAGCTAGCTGACTGATGCATGCTAGCTAGCTAGCTAGCTAGCTGACT

GATCGATGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTGATCGATCGATG

CTAGCTAGCTAGCTAGCTGATCGATGCTAGCTAGCTAGCTGACTAGCTGA

TCGATCGATGCTAGCTAGCTATAGCAGCAGCTAGCTAGCATGCTAGCATG

Gli antichi “mattoncini” del DNA messi al servizio, nuovamente, di una rediviva eugenetica nazista tecnologicamente avanzata. I subdoli obiettivi dei Savi di Sion sarebbero stati sbaragliati ancora una volta e il grande complotto sionista ai danni del mondo ariano non avrebbe visto, mai più, una nuova alba.

La muta alleanza

Posted in nigrologia with tags , , , , , , , , , , , , , , , , , , , , , on 29 aprile 2010 by Michele Nigro

Prequel n.1

“La muta alleanza”

Agli albori della FutureProg.

Roma – Città del Vaticano.

Su uno dei lati dell’obelisco pagano ricollocato, grazie a un interessante trasformismo secolare, al centro della cristianità mondiale, era stata incisa la seguente frase: “Ecco la Croce del Signore. Fuggite, o parti avverse. Vince il Leone di Giuda. Cristo regna. Cristo impera. E Cristo, contro ogni male, il popolo suo difenda”. L’ultima parte della frase, scelta secoli addietro da Papa Sisto V, possedeva una sinistra e quasi impercettibile somiglianza con un altro stralcio altrettanto celebre ma appartenente al ben più frivolo mondo della letteratura e dell’umana fantasia: “Un Anello per domarli, un Anello per trovarli, un Anello per ghermirli e nel buio incatenarli. Nella terra di Mordor, dove l’ombra cupa scende.”

Il pensiero dell’anziano cardinale non riandava certamente alla cosmogonia di Tolkien mentre osservava, per l’ennesima volta in maniera estasiata, l’imperturbabile obelisco di Piazza San Pietro dalla finestra del suo appartamento privato su Via della Conciliazione. Si trattava, tutt’al più, di un necessario ripasso interiore prima di affrontare quella fase cruciale e irreversibile della storia.

– Eminenza, mi scusi se la disturbo, il Signor Von Rauff è arrivato – annunciò con voce flebile la fedele perpetua affacciandosi sull’uscio dello studio tappezzato di libri e antichi ornamenti liturgici. Il cardinale, risvegliandosi dalla sua trance mistica, spostò quasi a forza gli occhi dal verticale testimone di pietra e lentamente li diresse verso quella esile figura terrena in devota attesa di istruzioni: – Lo faccia accomodare!

La sagoma mingherlina di Von Rauff, come il tronco di un giovane pioppo tormentato dal vento freddo e impetuoso del nord, oscillò freneticamente tra la porta dello studio e l’anello cardinalizio davanti al quale s’inginocchiò con la chiara e rispettosa intenzione di baciarlo: – Eminenza, grazie per avermi ricevuto! – proseguì con le frasi di rito.

– Siamo noi che dobbiamo ringraziare Lei e i suoi collaboratori per l’eccellente lavoro scientifico finora svolto, anche se si tratta di un lavoro prettamente teorico e, se me lo consente, ancora un tantino acerbo nella sua applicabilità – lo interruppe sorridendo il cardinale invitandolo a rialzarsi. – La stiamo osservando e seguendo con vivo interesse da molto, molto tempo… Lo sa? – aggiunse subito per incoraggiare il giovane ricercatore appena giunto da Berlino con un volo per Roma e ancora palesemente impacciato a causa del recente coinvolgimento del Vaticano nel progetto. Un progetto che durante quegli anni preliminari aveva ricevuto soltanto il silenzioso beneplacito di alcuni arteriosclerotici nostalgici nazionalsocialisti e nella migliore delle ipotesi qualche sostanzioso assegno staccato dal carnet di facoltosi industriali sfuggiti alla farsa giustizialista di Norimberga e capaci di riciclarsi nella ricostruzione di una Germania sconfitta, sì, ma ancora forte e orgogliosa. Molti, all’epoca dei processi di Norimberga, credettero ingenuamente di aver debellato il nazismo tramite quelle ridicole condanne capitali che ebbero solo la duplice funzione di far credere ai tedeschi di aver voltato pagina nel grande libro della storia e al mondo intero che gli americani, da quel momento in poi, avrebbero svolto, anche in Europa, un’attività di “polizia planetaria”.

– Ebbi modo di conoscere suo padre, Herbert Von Rauff, quando era di stanza qui a Roma, durante la Seconda Guerra Mondiale – il cardinale ricominciò dal passato, mentre passeggiava lentamente insieme al suo nuovo discepolo berlinese nel soleggiato corridoio che dallo studio portava alla cappella personale dell’alto prelato – e all’indomani della capitolazione dell’esercito tedesco lo aiutai a, diciamo così, trovare una nuova patria in cui poter vivere tranquillamente il resto della propria vita.

Il giovane Von Rauff ascoltava, mostrando un’aria apparentemente stupita, una storia che in realtà conosceva alla perfezione perché il tenente colonnello Von Rauff, suo padre, l’aveva raccontata e raccontata decine di volte ai suoi figli durante gli anni del dorato e tranquillo autoesilio uruguaiano, in America latina. – Fu grazie al mio personale interessamento e ad alcuni documenti falsi – continuava imperterrito il cardinale – se riuscì, una volta dismessi i panni di una divisa ormai divenuta scomoda, a riparare in un luogo sicuro. Riconobbi subito in suo padre una vivida fiamma di genialità non sanguinaria, una logica scientificamente applicabile: seppe distinguersi dai macellai del suo “gruppo”. Una genialità, tuttavia, non individuata in tempo e purtroppo non sfruttata quando serviva.

– Anche a causa dell’immaturità scientifica e tecnologica di quei tempi, aggiungerei, – il giovane Von Rauff ruppe finalmente il proprio silenzio con un entusiasmo che piacque al vegliardo – che non offrì alcuna possibilità di sviluppo alle idee lungimiranti di mio padre. Poi la guerra finì come finì… E quindi.

– Ma ho riconosciuto in Lei, leggendo i suoi studi sulla Trasmigrazione genica intergenerazionale, quella stessa fiamma. Solo che questa volta non rifaremo lo stesso errore sottovalutandola, con il rischio di farla definitivamente spegnere, mio giovane padawan.- il cardinale riprese con maggior fervore il suo paterno sopravvento – Come sta procedendo al riguardo?

– Come Sua Eminenza certamente saprà, sto cercando di creare a Berlino una società informatica assolutamente insospettabile e molto benvista dalla comunità scientifica e industriale del mio paese. Una società ancora in fase embrionale ma già potenzialmente impegnata in progetti avveniristici nel campo dei più sofisticati software biomedici – spiegò con un certo orgoglio teutonico il giovane Von Rauff mentre il cardinale gongolava interiormente e tradendo la sua gioia infantile sgranando nervosamente tra le mani un rosario fatto di pietre preziose: – Bene, bene… Molto bene! La sua neonata società riceverà in gran segreto dalle banche vaticane e dalle società scientifiche legate al nostro Stato, tutto l’appoggio logistico ed economico di cui necessita in questa delicata fase embrionale, non si preoccupi. – lo incalzò il cardinale.

– Ma il Santo Padre… Sa? – chiese ingenuamente il giovane, forse in un momento di filiale rilassamento.

– Non diciamo eresie! – il tono del cardinale divenne improvvisamente severo e il suo sguardo non aveva più alcuna traccia della precedente complicità – È ancora troppo presto per informare il Sommo Pontefice e non è neanche detto che debba essere proprio questo Papa a essere informato dei nostri piani. Anzi, a essere sinceri io non credo (Dio mi perdoni!) che l’attuale Vicario di Cristo possegga quella fermezza e quella lungimiranza necessarie per la promozione di un simile progetto. Questo è un Papa eccessivamente popolare e troppo impegnato a giocare con i giovani durante i raduni per occuparsi seriamente della questione ebraica. Dovremo attendere altri tempi. – pronunciò quell’ultima frase con uno sguardo lento e infinito, come di chi sa attendere secoli nascondendosi tra le pieghe silenziose e poco illuminate del tempo.

– Ora vada e mi tenga informato sugli sviluppi utilizzando i nostri canali sicuri, rodati dall’esperienza secolare e impenetrabili – congedò il giovane Von Rauff che rispose visibilmente commosso sussurrando: – Got mit uns!

– Sì, mio giovane e valoroso guardiano della purezza, può esserne certo: questa volta Dio sarà veramente con noi! – concluse il cardinale.

Il vecchio prelato, lentamente, guadagnò la porta della cappella mentre l’ora media incombeva sul ruolino di marcia delle preghiere quotidiane con cui sostenere spiritualmente il mondo. Come per miracolo riapparve la figura diafana della perpetua che avrebbe riaccompagnato il giovane berlinese verso il portone della casa del cardinale; non era ancora pronto per immergersi nuovamente nel piacevole caos della romanitas, ma la perpetua si rivelò cortesemente ferrea nel far rispettare gli orari delle visite.

Il giovane Von Rauff non si allontanò immediatamente dalla casa del porporato; ancora non aveva realizzato l’incontro e soprattutto non aveva metabolizzato a dovere il successo di quel proficuo colloquio. Rimase, infatti, per un paio di interminabili minuti dinanzi alla piccola targa marmorea che campeggiava in alto a destra sul citofono in ottone giallo della palazzina, mentre alle sue spalle una schiera corposa di spagnoli in visita guidata tra le vie di Roma armeggiava con ombrellini e cartine turistiche.

Non aveva più dubbi. La targa non mentiva e sotto il sigillo pontificio che l’adornava c’era scritto chiaramente: “S.E. Card. Joseph Ratzinger“.

Maria Pina Ciancio

Quaderno di poesia on-line

LucaniArt Magazine

Riflessioni. Incontri. Contaminazioni.

fantascritture - il blog di gian filippo pizzo

fantascienza e fantastico, ma anche no

Le parole e le cose

Letteratura e realtà

L'Ombra delle Parole Rivista Letteraria Internazionale

L'uomo abita l'ombra delle parole, la giostra dell'ombra delle parole. Un "animale metafisico" lo ha definito Albert Caraco: un ente che dà luce al mondo attraverso le parole. Tra la parola e la luce cade l'ombra che le permette di splendere. Il Logos, infatti, è la struttura fondamentale, la lente di ingrandimento con la quale l'uomo legge l'universo.

Also sprach

RIFLESSIONI E POESIE

Interno Poesia

Blog e progetto editoriale di poesia

Iannozzi Giuseppe - scrittore e giornalista

Iannozzi Giuseppe, in arte "Joseph Barbarossa" - scrittore, giornalista, critico letterario - blog ufficiale

Emanuele-Marcuccio's Blog

Per una strada e altre storie...

HyperHouse

NeXT Hyper Obscure

DEDALUS: corsi, testi e contesti di volo letterario

Appunti e progetti, tra mura e spazi liberi

i sensi della poesia

e in pasto diedi parole e carne

La Camera Scura - il blog di Vincenzo Barone Lumaga

Parole, storie, pensieri, incubi e deliri

La Mia Babele

Disorientarsi..per Ritrovarsi

%d blogger hanno fatto clic su Mi Piace per questo: