Archivio per Israele

Generation

Posted in nigrologia with tags , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , on 13 luglio 2014 by Michele Nigro

Ru486

Non morirete di pacifica noia

figli e nipoti del futuro!

Nuove leve per un ciclico terrore

concepite all’ora di cena tra dolori

oscurati sulle tv dell’impero sensibile

nasceranno puntuali e cieche

scivolando fuori da placente rabbiose

di allignate ingiustizie occidentali.

Annunci

Frate Kerouac

Posted in nigrologia with tags , , , , , , , , , , , on 1 aprile 2013 by Michele Nigro

02-00173197

<<… Non ho ancora trovato la tomba di Schindler, ma domani continuerò la mia ricerca con informazioni più sicure. Anche perché non posso leggere le iscrizioni su tutte le tombe di Gerusalemme! Che giro ragazzi oggi! Stavo morendo disidratato sotto il sole di Palestina. Ho visto molto della zona est e ho pranzato tardi: alle 16…

Tornando a Casa Nova mi sono concesso una doccia, ho rasato la barba e ho cenato. E il dopo cena è stato interessante perché ho fatto quattro chiacchiere con il simpatico e molto estroverso direttore di Casa Nova che è, indovinate un po’, un “francescano”! Anche se vedendolo a tutto si penserebbe ma non che si tratti di un religioso: jeans, camicia, uno scotch whisky “on the rocks” in una mano e una sigaretta accesa nell’altra. Seduto sulla poltrona del bar di Casa Nova, ci ha eruditi sulla sua vita fricchettona e sul perché fosse diventato frate. Praticamente un Jack Kerouac latino (ci è sembrato che parlasse in spagnolo con i dipendenti anche se con noi ha utilizzato un ragionevole italiano) che dopo aver trascorso una giovinezza “on the road”, girando in moto l’America del Sud, si ritrova a fare il francescano in terra santa… Che personaggio! Con noi si è aperto di più che con gli altri pellegrini, anche se lo abbiamo visto sempre giocare con i bambini dei turisti facendo loro il solletico: forse vedendoci tutti impolverati, sudati e ricoperti di zaini, avrà ripensato per un attimo alla sua giovinezza scapestrata. Anche se non sono sicuro che quella sua giovinezza sia del tutto finita. Lo vedo ancora “on the road”… Lasciamo che il frate finisca il suo scotch e ci avviamo, nonostante la giornata piena vissuta, verso un’altra notte tra le strade di Gerusalemme. […]

Abbiamo fatto di nuovo le 3 del mattino! Stavolta ci cacciano da Casa Nova. Ma per fortuna il “frate beat” ci concede un’ulteriore deroga sugli orari. Adoro questi religiosi elastici che non opprimono la libertà dei laici.>>

(tratto da Viaggio in Israele)

L’afa di Eilat

Posted in nigrologia with tags , , , , , , , , , , on 23 agosto 2011 by Michele Nigro

Dedicata a questi giorni di afa in Italia. Incredibilmente la pagina di diario che segue mi è tornata in mente la scorsa notte, non riuscendo a dormire a causa del caldo, tra il 22 e il 23 agosto del 2011: esattamente diciassette anni dopo l’esperienza dell’afa di Eilat. Gli orologi della memoria scattano silenziosamente ma con decisione insonne; seguendo scadenze e anniversari inconsci ci risvegliano dalla monotonia. L’afa israeliana, i corsi e ricorsi della storia personale, la riproposizione dei contenuti e l’inganno delle forme che cambiano, il contrasto tra il turismo stanziale e l’esperienza “di passaggio”, la solitudine alberghiera su uno sfondo paradisiaco, l’osservazione quasi scientifica e morbosa contro la rilassatezza delle comitive di amici, l’inadeguatezza dell’anima e il sentirsi “fuori dal tunnel del divertimento”, la contrapposizione tra deserto e mare, tra la ricerca superiore e il divertimentificio, tra la voglia di essere soli e l’obbligo allo svago… Il capitare quasi per caso in un luogo vivo e la strana gioia provata nel ripartire.

<<… La mia parte assente s’identificava con l’umidità…>> cantava Franco Battiato in Arabian Song. Un’umidità deprimente, asfissiante, capace di aggravare la dissociazione tra mente e corpo, di evidenziare il divario tra l’obiettivo interiore e il caos esterno. Ma come recita un adagio: “Non si va mai tanto lontano come quando ci si perde.”

22-08-1994

Lascio il Youth Hostel di Mizpè Ramon e con l’autobus 392 mi dirigo alla volta di Eilat.

Lungo la strada incontro solo “il deserto dei padri” e basi militari a testimoniare la vicinanza con i confini di quei paesi arabi che anni fa diedero del filo da torcere a Israele: Egitto e Giordania. Scendendo sempre più a sud Israele assume una forma curiosa, come si può apprezzare dalla cartina: diventa triangolare, a imbuto, con la punta rivolta verso il Golfo di Aqaba. E proprio alla punta di questo “imbuto geografico” c’è Eilat, ultima località dello stato d’Israele. Fiorella Mannoia in Italia ha dedicato anche una canzone a questo luogo – “Sorvolando Eilat” – e in una strofa la cantante dai capelli rossi fa riferimento alle caratteristiche “montagne rosse” che si vedono poco prima di giungere a Eilat. Una volta superate le montagne rubiconde appare la “Rimini del Mar Rosso”.

Caotica, viva, calda (più calda di tutti i posti in cui sono stato da quando sono sbarcato in Israele), troppo turistica per i miei gusti e sicuramente dedicata a chi ama il caldo tropicale e  vuole fare una vacanza solo ed esclusivamente per divertirsi, senza obiettivi culturali. Eilat è un “divertimentificio”, la classica città di mare con forte vocazione turistica in cui io personalmente non passerei mai per intero le mie vacanze estive. Un giorno, due giorni… E via. Comunque ho voglia di conoscerla e quindi mi dirigo alla ricerca di un posto per la notte. All’Ufficio Turistico mi propinano una guida commerciale che non serve a niente e mi dicono di tentare all’ostello. Niente da fare: tutto pieno. Allora “agguanto” una stanza in un hotel di media categoria e mi libero dagli zaini che diventano ogni giorno più pesanti. E’ una stanza singola tutta per me con un comodissimo lettone e l’aria condizionata che prontamente accendo “a palla”. Approfitto dell’ampio bagno per fare… “il bucato”: lavo le magliette e il resto del vestiario sporco, che in seguito appendo sulla mia provvidenziale cordicella già protagonista di altri bucati raminghi. I panni si asciugano in un batter d’occhio. Eilat: 42°C. Un vero inferno! […]

Continua a leggere

Baini ubaink ya hallail! (“Tra me e te, oh notte!”)

Posted in nigrologia with tags , , , , , , , , , , , , , , on 3 luglio 2011 by Michele Nigro

“Baini ubaink ya hallail”
canzone della tradizione mediorientale

(pronuncia)

Baini ubaink ya hallail
Fi h’ob ukènneieh
Ala bab’ btokod ya lail
Umenshar laileieh

Baini wbainak fi asrar
Wbteàref ahzani
Btebà mreàli a hak eldar
Wtek’olon ma yensuni

Rit. Bait elsaa’d elatik
Kafi ala eltarik wkafi haddu’ elzaman
Yemken bokra elhabib
Yomrok methl elkarib w’ma yuzkur ellikan

Bayni wbainak dakket ab
Kamzet aw wsada hob
Zekra helwe wsharket shams
Welnada byektor alkalb

Bayni wbainak sahret kamr
Helm twil blailet sahr
Lelmatar kalbi atshan
Kalbi wkalbak habbet matr.

***************************

(traduzione)

“Tra me e te, oh notte!”

Tra me e te, oh notte mia
C’è un amore e una canzone
Stai vicino alla mia porta
E passiamo il tempo insieme.

Tra me e te ci son segreti
Tu conosci la mia tristezza
Passa vicino alla sua porta
E dille “non dimenticarlo!”

Rit. Quella casa felice
Che stava sulla strada
Nasconde i miei ricordi.
Il mio amore passerà
Come un estraneo poi
Niente ricorderà!

Tra me e te un cuore palpita
C’è un intenso eco d’amore
Dolce sole che risorgi
La rugiada sul mio cuore.

Tra me e te notte romantica
C’è un dolce e lungo sogno
Nostalgia per il mio cuore
Nostalgia di un vecchio amore”.

AUDIO CORRELATO

Registrazione su audiocassetta del 7.6.1995 a Torre del Greco (Napoli)

Traduzione e adattamento dall’arabo all’italiano della canzone “Baini ubaink ya hallail” a cura di Marjyia Yusuf (Nazareth – Israele) e Michele Nigro.

Alle chitarre: Yusuf Marjyia (classica); Michele Nigro (acustica)

Voce e fischio, versione n.1: Yusuf Marjyia

Versione n.2 (dal minuto 3:36): fischio (1° fischio: Y. Marjyia/2° fischio: M. Nigro) e canto (voce: Y. Marjyia)

Dedicato a Vittorio “Vik” Arrigoni

Posted in nigrologia with tags , , , , , , , , , , , , on 18 aprile 2011 by Michele Nigro

16-08-1994

Il muezzin di Betlemme è già a lavoro…

La camera 305 dello Star Hotel è bellissima. Forse il mio entusiasmo è eccessivo, ma dopo aver dormito su ponti di navi e letti di fortuna, questa stanza (al di là della sobria e comodissima stanza al ‘Casanova’ di Gerusalemme) mi appare come una reggia. Ci sono molti piani in questo albergo e ad una prima occhiata sembrerebbe “disabitato”: non ho visto altri turisti nell’atrio o sui piani come dovrebbe essere in un normale albergo. Forse sono tutti turisti che si svegliano con il canto del gallo oppure non è un albergo ‘gettonato’ a causa del territorio ‘difficile’ in cui sorge. Andiamo nella sala da pranzo che offre, grazie ad un’ampia vetrata, uno spettacolare panorama su Betlemme. E’ bello fare colazione guardando dall’alto ciò che ti aspetta. Facciamo colazione e nella sala siamo in tre. In un tavolo non molto lontano c’è (quando dici il destino) un italiano: un tecnico di Torino in viaggio di affari abituato a fare colazione con la valigetta del lavoro affianco al tavolo. Il sole attraverso la vetrata ci riscalda e ci invoglia ad abbandonare la colazione per scendere, finalmente, tra le strade di Betlemme. Dopo aver trascorso delle serate per così dire “mondane” tra i pub di Jaffa Road e della Gerusalemme “pagana”, è un po’ difficile, ma sicuramente educativo, vedere la situazione di Betlemme. Sottolineo “vedere” perché è diverso dal “sentito dire” come spesso succede a chi, come me, vive in Europa o altrove.

La piazza centrale di Betlemme è caratterizzata dalla presenza di un ampio portico dove ci sono numerosi negozi per turisti; su un lato c’è una moschea con un bel minareto che domina la piazza e su un altro lato ancora c’è una stazione della Polizia israeliana tutta circondata da reti metalliche e con una torretta d’avvistamento per le guardie armate. I mezzi blindati sono parcheggiati nel cortile ricavato dal recinto di rete e in attesa di momenti “caldi”… […] Dopo aver visitato e fotografato i luoghi della cristianità, ci siamo lanciati all’esplorazione di posti che mai nessun soldato israeliano o tour operator sano di mente vorrebbe esplorare. Ci sono vie (o cose che sono simili a vie) in cui si sente (e si vede, e si tocca) la povertà, l’abbandono, il degrado, l’indifferenza dello stato israeliano, la libertà autogestita del popolo palestinese… Ci sono vicoli il cui odore è insopportabile perché deriva da un misto di feci di animali e marciume vario… Nella zona del mercato non si riesce a distinguere dove sia il fondo di quella che dovrebbe essere una strada perché completamente ricoperta di terriccio, feci di galline portate a vendere, piume e penne di vari volatili commestibili… Il tutto mischiato a formare una melma miasmatica che stimola il vomito anche in chi come me è abituato a sezionare ascessi purulenti e animali in via di putrefazione… In moltissimi angoli delle strade cumuli di rottami arrugginiti di quelli che sarebbero potuti essere macchine o motori, dominano il paesaggio indisturbati chissà da quanto tempo. La gente del posto, abituata a tutto questo, ti ferma solo per venderti cartoline, per cambiare denaro in nero, per proporti un affare con il proprio taxi sgangherato… Se non ti fermano, si accontentano di dirti “hello!” con la speranza di attaccare discorso e di riuscire a guadagnare qualche schekel accompagnandoti in qualche posto nei dintorni. I bambini, dalle scale e dai muri, un po’ timidamente e un po’ con la voglia di entrare in contatto con qualcosa di nuovo, ti gridano un audace “what’s your name?”…

E mentre il tramonto di Betlemme si trasforma in una dolce coperta di color arancio posandosi lievemente sui margini delle montagne vicine, e mentre i miei panni lavati ondeggiano sulla finestra ampia dell’albergo (grazie alla provvidenziale “cordicella” per i panni che fa parte del mio bagaglio di buon italiano in viaggio), con la musica degli U2 nelle orecchie sto scrivendo queste memorie.

Gli sguardi dei palestinesi che incontro per strada sono sguardi che penetrano ogni cosa… Sono sguardi curiosi che fissano la mia macchina fotografica (forse perché non è un granché e allora pensano “poveraccio”: in realtà la mia macchina sembra uscita in regalo da una busta di patatine, anche se devo ad essa le uniche foto che testimoniano questo viaggio), fissano le mie scarpe, la mia maglietta, i miei occhiali da sole… Sono una mosca bianca tra i vicoli di un mondo difficile?

Tutto ciò che dalla Piazza della Mangiatoia (dove sta la Basilica della Natività) si muove oltre i luoghi sacri dove i palestinesi sono abituati a vedere gli europei, viene visto come un oggetto strano che invade luoghi appartenenti ad una dimensione prettamente palestinese.

La polizia israeliana ha la sua caserma vicino alla Basilica della Natività ed è completamente circondata (come ho già scritto) da una gabbia di ferro… Quella caserma è come un pezzo di Israele che si trova per sbaglio nel mondo palestinese! Gli israeliani pensano che questo sia territorio occupato solo perché i soldati armati fino ai denti camminano tra le strade con il rischio di essere colpiti da bottiglie o pietre… Stamattina nel mercato c’è stata una “mini intifada” durata pochi secondi tra alcuni ragazzini che lanciavano pietre e i soldati israeliani che pattugliavano il mercato. Secondo il taxista che sosta vicino alla moschea in attesa di clienti, queste sono cose che succedono tutti i giorni e lo dice con la faccia rassegnata di chi ci vive in mezzo…

Qui a Betlemme (molto più che a Nazareth) si sente che la presenza israeliana è come un punto nero disegnato sul foglio bianco del popolo palestinese. I giovani arabi e i bambini si avvicinano con spontaneità: qualcuno per chiedere soldi, altri una penna, altri semplicemente per conoscere, per sapere, per toccare qualcuno di nuovo. Ieri sera quando siamo arrivati ci siamo sentiti come gli “americani” mentre entravano vittoriosi nelle città europee appena liberate durante la seconda guerra mondiale… In meno di due secondi, se ti fermi per chiedere informazioni, si forma un primo strato di “scugnizzi palestinesi” e poi se non cambi aria lo strato diventa folla… Una piacevole folla acerba di ‘grilli palestinesi’ trasformati in bambini che pigolano e saltellano intorno alla novità.

Giudicare i palestinesi è difficile perché vivono in condizioni poco felici e molti di loro utilizzano l’Intifada per manifestare la rabbia contro uno stato imposto dalla storia che non assicura né lavoro, né possibilità di movimento, né futuro… Giudicare gli israeliani è altrettanto difficile perché anche loro, alla ricerca di una identità nazionale, si sono trovati dinnanzi all’infelice compito di convivere con un popolo culturalmente diverso e giustamente ‘incazzato’. E’ come far fare un viaggio di migliaia di km in una macchina a due persone che non si vogliono parlare e che addirittura si odiano per rancori lenti a spegnersi o per torti subiti in passato… Bisogna unire le forze positive arabe e israeliane in un discorso non passionale ma pratico e lungimirante: cioè trovare un modo, al di là dell’orgoglio e dell’odio, per stare bene insieme nella stessa terra.

“Non tutti vogliono la pace…!” mi diceva oggi il taxista al centro. Certo, ma non tutti vogliono la guerra.

Continua a leggere

L’eugenetica del Dottor E

Posted in nigrologia with tags , , , , , , , , , , , , , , , , , , , , on 29 aprile 2010 by Michele Nigro

Prequel n.2

“L’eugenetica del Dottor E”

Nei laboratori della FutureProg.

Qualche anno prima della grande caccia al programma.

Mentre tamburellava con la matita sui raccoglitori accumulati nello scaffale e ripieni di analisi di laboratorio effettuate in quei duri anni di lavoro e di campionatura, il Dottor “E”, così l’avevano ribattezzato i suoi più stretti collaboratori lì alla FutureProg, non poté fare a meno di rimuginare sugli imprevisti e a dir poco sconvolgenti risultati segreti del beta testing di “Sion 2”.

Un nome biblico per un programma che avrebbe dovuto gestire il lavoro complesso e delicato dei tanti laboratori di analisi cliniche sparsi nel mondo e messi in rete. Se gli affari fossero andati come aveva previsto il fiducioso amministratore delegato direttamente piombato dalla sede centrale per assistere ai primi vagiti dell’applicazione – … il mondo non sarebbe stato più lo stesso… – queste le esagerate e ottimistiche parole usate dal pezzo grosso durante un’innocua pausa caffé. Parole a cui non aveva mai dato o non aveva mai potuto dare, in quanto reso inoffensivo dalla mancanza di dati più “intimi”, la giusta importanza.

– Chissà perché un nome biblico – continuava a chiedersi il Dottor “E”. Forse per impressionare gli informatori impegnati nei loro giri danteschi alla ricerca di possibili acquirenti o forse per impressionare gli stessi acquirenti, compresi i politici impegnati nella complessa gestione sanitaria dei paesi rappresentati, facendo leva sulla loro reverenziale coscienza religiosa collettiva ben nascosta tra le pieghe più arcaiche del cervello.

Ora, però, conosceva il vero perché di quel nome. Ma era troppo tardi. O forse no…

Dunque, i contagiosi “Protocolli dei Savi Anziani di Sion” avevano finalmente trovato la loro terapia globale in quel programma informatico capace di gestire, tramite la Rete, i dati di migliaia di laboratori sparsi nel mondo, in barba alle più elementari leggi sulla privacy con cui i politici si facevano belli dinnanzi alle telecamere e agli elettori.

Dopo l’eclatante fallimento nazista del secolo scorso e la storica diluizione degli sforzi eugenetici in tanti piccoli rivoli insignificanti, presto dimenticati, la subdola risposta all’oltraggiosa fondazione dello Stato di Israele si era trasformata con il tempo in uno dei progetti più capillari della storia umana. Chi, almeno una volta durante la propria vita e per i motivi più disparati, non aveva avuto bisogno di compiere delle semplici e routinarie analisi del sangue o non aveva depositato la propria saliva per un semplice test infettivistico? Tutti… Già, proprio tutti. Prassi quasi quotidiana nell’allarmistica e ben curata società del terzo millennio. Almeno in quella ricca, quella che conta dal punto di vista economico e tecnologico.

– Che ingenuo, sono stato! – pensava il rinsavito Dottor “E” mentre ripercorreva mentalmente le fasi più importanti dell’elaborazione del “Pacchetto Sion 2”. Non solo gestione dei dati in Rete, dunque, ma anche ricerca eugenetica camuffata da propositi umanistici e di ordine pubblico – L’Organizzazione Mondiale della Sanità ci ha chiesto espressamente di compiere una ricerca su vasta scala, tramite “Sion 2”, di quei fattori genetici che predisporrebbero gli individui all’uso di droghe e alcol… per bloccare l’impressionante parabola di omicidi, suicidi, incidenti stradali e sul lavoro, in tutto il mondo… – gli avevano detto alla vigilia del beta testing.

– Dottor “E”… “E” come Eugenetica! – rise amaramente – Dunque i miei più stretti collaboratori, i miei “amici” qui alla FutureProg, sapevano e sanno?

Ora tutte le tessere di quel mosaico invisibile ma reale si stavano riordinando pian piano nella sua sconvolta psiche di essere umano deluso e sfruttato. “Sion 2” avrebbe dovuto funzionare pressappoco così: il programma che gestiva il computer interno agli analizzatori, oltre a svolgere le sue normali e banali funzioni sequenziali, sarebbe stato in grado, parallelamente, di compiere una precisa e non autorizzata ricerca genetica sui campioni di sangue giunti in laboratorio. Una ricerca capace di stanare, negli anfratti cromosomiali delle cellule sanguigne, le più insignificanti tracce genomiche israelite tramandate nel tempo e insabbiate dai naturali incroci che la moderna e libera società globalizzata rendeva possibile ormai da decenni ai suoi inconsapevoli figli da redimere.

Tutto era cominciato alcune settimane prima.

Durante le fasi finali del beta testing, il Dottor “E” non riusciva a spiegarsi quella sigla cifrata che di tanto in tanto compariva al lato del numero di campione: … E-45671-I, E-45672-I, E-45673-I…

Il database aziendale non forniva risposte esaustive, ma forse il computer del Capo Sezione non gli avrebbe mentito. Così, durante una delle innumerevoli notti insonni trascorse a betatestare il mostro informatico dai mille volti, il Dottor “E” fece una visitina non autorizzata nell’ufficio del Capo Sezione. Conosceva la scarsa fantasia del soggetto e avrebbe scovato la password del suo personal computer in un batter d’occhio.

– Il fesso avrà messo sicuramente il nome della figlia! – ma cliccando su “invio” si accorse che il tizio, forse, aveva preso lezioni serali di furbizia e quindi avrebbe dovuto riprovare chissà per quante ore prima di beccare la password giusta.

– Dai, dimmi quale è la password: non hai una vita interessante! Sei monotono come il ticchettio di un orologio a corda… Sei noioso come una sinfonia di Berlioz… Sei prevedibile come la mia sveglia delle 7… Quale cacchio di password avrà mai potuto partorire la tua mente ammuffita? Rilancio con il nome di tua moglie, dal momento che la nomini trecento volte al giorno. Ma non può essere così facile! – invece lo era. – Confermo: sei un fesso!

La cartella intitolata “Sion 2” era come uno scrigno ricolmo di dolorose sorprese e finalmente, nel suo notturno curiosare a caccia di prove in grado di confermare i suoi striscianti sospetti, quel codice cifrato comparve seguito da una esaustiva legenda – Eccolo! E-xxxxx-I… – l’aveva trovato. Poi continuò a visionare stupefatto la spiegazione delle lettere e dei numeri che lo componevano – Dove “E” sta per (manco a dirlo!) Eugenetica, xxxxx è il numero ordinario dei campioni risultati “positivi” e “I” sta per… – fece una pausa durante la quale sentì il proprio cuore saltargli in gola come in preda a una sorta di danza ritmica – … sta per “Israelita”.

– Ma che c’azzecca con l’alcol e la droga? Quale interazione può esserci con delle normali analisi del sangue? – continuava imperterrito a tergiversare ingenuamente mentre la scottante realtà dei fatti gli tirava il camice da laboratorio come per dire “ehi, sono qui!”

Rielaborando le sconvolgenti scoperte durante le settimane successive, il Dottor “E” raggiunse finalmente quella serenità che deriva dalla totale, seppur dolorosa, presa di coscienza di uno stato di cose che avrebbe potuto definire fantascientifiche, ma che rappresentavano, invece, la realtà per cui aveva inconsapevolmente lavorato in quegli ultimi anni.

– Perché individuare proprio quella precisa traccia genica? – aveva continuato a indagare tra le possibili applicazioni di “Sion 2” – Perché evidenziare l’eredità genetica israelita negli esseri umani del terzo millennio?

Lentamente il disegno malvagio di selezione genetica insito nell'”innocuo” programma informatico, stava prendendo forma nella mente incredula e interrogativa del Dottor “E”.

“Sion 2” avrebbe dovuto completare su scala mondiale l’interrotta “Soluzione Finale” ideata dai nazisti di Hitler durante il cosiddetto “secolo breve”: estirpare dal DNA dell’Umanità ogni ombra sionista capace di minare la tanto agognata resurrezione della stirpe ariana.

Non più rastrellamenti, fucilazioni, ghettizzazioni, forni crematori, fosse comuni o improponibili campi di concentramento dove stipare i “pezzi” in attesa di macabre docce a base di Zyklon B; non più treni della morte e improbabili partiti nazionalsocialisti che sarebbero stati sbarazzati sul nascere da un’opinione pubblica assopita, è vero, dalla tecnologia e dalle nuove droghe mediatiche, ma ancora resa memore dall’immane quantità di dati e di immagini ereditate dalla terribile esperienza storica della Shoah.

“Sion 2” rappresentava la silenziosa e globalizzata ripresa di un discorso interrotto dalle mire espansionistiche di sovietici e americani, che intervennero durante la seconda guerra mondiale non certamente per motivi umanitari, ma per allargare, ognuno a modo proprio e seguendo una personale tempistica, i propri orizzonti ideologici e, non ultimi, commerciali.

Il muro di Berlino e la Guerra Fredda ne furono le prove più evidenti.

Stavolta no. L’epurazione sociale avrebbe sfruttato le normali e legali vie della competizione aziendale; il curriculum lavorativo di un soggetto sarebbe stato condizionato dai risultati delle analisi di “Sion 2”; il pestifero popolo israelita, ancora presente e perfettamente diluito tra le genti di tutto il mondo, sarebbe stato selezionato e messo al muro non grazie all’eliminazione fisica, come era accaduto in passato, ma utilizzando un’indolore e quasi impercettibile selezione socio-economica. Banditi dalle aziende, dai posti di lavoro, dalle cariche pubbliche, dalle responsabilità civili che rendono un soggetto umano indispensabile e utile… Tutto questo senza mai nominare la parola “israelita”.

Il trucco? Attribuire a quel codice cifrato una qualsiasi inventata malattia genetica irreversibile, una malsana predisposizione all’alcol e alla droga, un riconosciuto impulso all’omicidio, una dannosa aspirazione al suicidio. Una plausibile causa di licenziamento o di mancata assunzione. Tutte notizie personali false e non diffusibili, ma che l’Organizzazione Mondiale della Sanità, i Ministeri della Sanità delle varie nazioni e le numerose aziende del pianeta avrebbero senz’altro apprezzato, ufficiosamente, in termini di previsioni capaci di evitare fastidiose perdite di risorse umane e dispendiose cure da caricare sui bilanci assicurativi.

Isolare e distruggere socio-economicamente un’intera razza e le sue diramazioni genetiche: questo era lo scopo di “Sion 2”.

ATCGTAAGATCGATAGTCGATTAGCTGATCGATGCTAGCATTATGCTAGTA

CTAGCGACGACGATGCTAGCTAGCTAGCTGACTGGTGTCGTAGCTGATCG

GTGTATGAGAGATTTATTTCCCGCGAGTCAGTCAGTCAGTACGTCTGCTAG

TCTGACTACTGCTGCAGTCAGACTGCATGCTGCAGTCTGCATGATCAGCT

AGCTGACTGACTGCAGTCAGTCGCAGCGAGGGAGAAATTCTTCCTCTCCC

TAGCAGCTAGTGGCTGACGTAGCTAGCTGATGCTAGCTGATCGTAGCTGA

TCGATCGTAGCATGCTAGCTAGCGACGAGCTAGCTAGCTGATCGAGCTAG

CTGATCGATGCTAGCTAGCTAGCTGACTGACGATGCTAGCTAGCTAGCTA

GCTAGCTAGCTAGCGATCGATGCTAGCTAGCTAGCTGACTGATCGATGCT

AGCTAGCTAGCTGACTGATGCATGCTAGCTAGCTAGCTAGCTAGCTGACT

GATCGATGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTGATCGATCGATG

CTAGCTAGCTAGCTAGCTGATCGATGCTAGCTAGCTAGCTGACTAGCTGA

TCGATCGATGCTAGCTAGCTATAGCAGCAGCTAGCTAGCATGCTAGCATG

Gli antichi “mattoncini” del DNA messi al servizio, nuovamente, di una rediviva eugenetica nazista tecnologicamente avanzata. I subdoli obiettivi dei Savi di Sion sarebbero stati sbaragliati ancora una volta e il grande complotto sionista ai danni del mondo ariano non avrebbe visto, mai più, una nuova alba.

Pomeriggi perduti

di Michele Nigro

Iris News

Rivista di poesia, arte e fotografia

adrianazanese

Just another WordPress.com site

POLISCRITTURE

laboratorio di cultura critica a cura di Ennio Abate

Mille Splendidi Libri e non solo

"Un libro deve essere un'ascia per il mare ghiacciato che è dentro di noi"

Poetarum Silva

- Nie wieder Zensur in der Kunst -

Leggo e cammino

Amo leggere, amo camminare e amo fare le due cose insieme (non è così difficile come sembra)

Maria Pina Ciancio

Quaderno di poesia on-line

LucaniArt Magazine

Riflessioni. Incontri. Contaminazioni.

Fantascritture - blog di fantascienza, fantasy, horror e weird di gian filippo pizzo

fantascienza e fantastico nei libri e nei film (ma anche altro)

Le parole e le cose²

Letteratura e realtà

L'Ombra delle Parole Rivista Letteraria Internazionale

L'uomo abita l'ombra delle parole, la giostra dell'ombra delle parole. Un "animale metafisico" lo ha definito Albert Caraco: un ente che dà luce al mondo attraverso le parole. Tra la parola e la luce cade l'ombra che le permette di splendere. Il Logos, infatti, è la struttura fondamentale, la lente di ingrandimento con la quale l'uomo legge l'universo.

Iannozzi Giuseppe - scrittore e giornalista

Iannozzi Giuseppe -scrittore, giornalista, critico letterario - blog ufficiale

Emanuele-Marcuccio's Blog

Ogni poesia nasce dalla meraviglia...

DEDALUS: corsi, testi e contesti di volo letterario

Appunti e progetti, tra mura e spazi liberi

i sensi della poesia

e in pasto diedi parole e carne

La Camera Scura - il blog di Vincenzo Barone Lumaga

Parole, storie, pensieri, incubi e deliri

La Mia Babele

Disorientarsi..per Ritrovarsi

%d blogger hanno fatto clic su Mi Piace per questo: