Archivio per laboratorio

I Ragazzi di via Panisperna

Posted in nigrologia with tags , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , on 3 aprile 2017 by Michele Nigro

versione pdf: I Ragazzi di via Panisperna

Film lunghissimo, mai noioso. Nell’incipit viene descritto lo “scherzo” in stile futurista da parte di un gruppo di studenti di Fisica ai danni del “vecchio” Guglielmo Marconi, visto ormai come la personificazione di una forma di “passatismo scientifico” che non lascia spazio alle nuove scienze, alle nuove idee appena sognate e non ancora dimostrate, ai suoi giovani e scalpitanti protagonisti. Siamo in piena era fascista, il sapere e le scoperte scientifiche devono assecondare i sogni di gloria dell’uomo solo al comando e del suo impero, non c’è spazio per le farneticazioni teoriche. Eppure, invece di essere puniti dal preside Corbino, gli irriverenti goliardi vengono incoraggiati a proseguire sulla nuova strada e coordinati nelle ricerche dal professore Enrico Fermi firmeranno importanti scoperte nel campo della fisica nucleare. Accanto a Emilio Segrè, Bruno Pontecorvo, Edoardo Amaldi, si distingue per genialità e sensibilità (scambiata dalla maggior parte dei conoscenti per fragilità) la figura “misteriosa e unica” di Ettore Majorana. Due tipologie umane, due caratteri scientifici, due linee parallele che, contrariamente a quanto stabilito dall’assioma geometrico, s’incontrano spesso per poi separarsi, ma è un avvicinarsi asintotico: Majorana, pur contribuendo alle scoperte e spesso anticipandole senza tuttavia renderle pubbliche, non si integrerà mai del tutto all’entusiasmo scientifico del gruppo, ne resterà sempre ai margini.

Dal film, che segue giustamente la trama storica dei traguardi scientifici caratterizzanti un’epoca gloriosa della ricerca scientifica italiana (passando dalla radio di Marconi alla radioattività di Fermi!), emerge soprattutto la particolarità psicologica di Ettore Majorana, e non solo per il misterioso epilogo della sua storia personale quanto piuttosto perché rappresentò uno scomodo “mezzo di contrasto” scientifico e di pensiero non solo all’interno del gruppo di scienziati di via Panisperna ma anche nei confronti di un intero periodo storico delicato.

Nel film di Gianni Amelio bene è evidenziato il disagio esistenziale di Majorana che convive e spesso si scontra con il pragmatismo di Fermi e gli altri ricercatori: ma non si tratta di un disagio invalidante, anzi; l’essere un tipo silenzioso, la voglia di solitudine, le oscillazioni caratteriali, il suo schermirsi dai sentimenti, distraggono l’interlocutore dal suo essere invece un intelligente anticipatore. Un’anticipazione che non si manifesta solo attraverso una straordinaria velocità di calcolo matematico ma anche per mezzo di una visione del mondo che lo rende inevitabilmente un emarginato. Un'”emarginazione geniale” che, nonostante tutto, lo condurrà in Germania al fianco di Heisenberg… Il suo essere un critico anticipatore ebbe per alcuni il sapore dello sberleffo: i traguardi di Fermi e dei ragazzi di via Panisperna – la scoperta sbandierata degli elementi Ausonio ed Esperio, fin dalla scelta dei nomi, denunciava un’autoreferenzialità tipica del regime fascista e un entusiasmo scientista non supportato da una visione d’insieme lungimirante – furono in un certo qual modo tenuti a debita distanza dallo stesso Majorana, forse perché lo scienziato siciliano aveva già preconizzato il loro maldestro utilizzo per scopi bellici (come a breve distanza di tempo sarebbe avvenuto!).

Se fossero stati gli americani a realizzare il film, sicuramente avrebbero aggiunto qualche effetto speciale mirabolante per meglio sottolineare gli argomenti di fisica atomica: invece vi è una scena importante, nella sua estrema semplicità, che vale l’intera pellicola anche senza il supporto di effetti; quella in cui un Majorana sconvolto e paranoico spiega a uno studente impaurito, sorpreso a mettere ordine nell’aula del dipartimento di Fisica, che nel nucleo non vi sono protoni ed elettroni – come affermato dallo stesso Fermi – bensì protoni e delle non ancora definite “particelle fantasma” (ovvero i “protoni neutri”)… E poi, mostrando allo studente la punta di una matita, afferma che se la punta è il nucleo dell’atomo, bisogna immaginarsi l’intera aula occupata dagli elettroni orbitanti e non più relegati all’interno del nucleo. Le capacità visionarie di Majorana, corroborate dal calcolo matematico, sembrerebbero non voler contribuire al successo di Fermi ma sono volutamente tenute a freno: più volte nel film il personaggio di Ettore Majorana dà fuoco ai propri preziosi appunti contenenti formule matematiche in grado di dimostrare in anticipo teorie fisiche importanti a cui i suoi amici di via Panisperna giungeranno col solito distacco temporale; come a voler tacere pur sapendo, per paura di dare forma concreta alla propria consapevolezza matematica.

Continua a leggere

La nevicata del 2012

Posted in nigrologia with tags , , , , , , , , , , , , , , , , , , on 6 luglio 2013 by Michele Nigro

535198_139910436137182_100003546783363_146105_1074735313_nLa neve scendeva ch’era un piacere. Mare grigio e bianco dappertutto. Il giorno di Pasqua. Da non credere. Il saluto del cielo al mio primo giorno di disoccupazione fu una nevicata da notizia in prima pagina: 5 Aprile neve sulla costa della Calabria. Ed io stavo imbambolata ai vetri della finestra guardando quei fiocchi bianchi che cadevano sulle mie prime ore di libertà. Senza neanche la tentazione di andare a comprare i giornali. Tutti i miei incarichi in giro per il mondo inabissati sotto quel morbido tappeto bianco, insieme ad una lettera di dimissioni scritta al volo in uno squarcio di lucidità. Di cui non ricordavo più neanche una parola.

Avevo preso alla lettera la poesia di Martha Medeiros capovolgendo il tavolo della mia esistenza fino a quel punto ordinata e noiosamente prevedibile. Tutti gli impegni nell’agenda del futuro erano stati disdetti. Ogni fiocco rappresentava una nuova possibilità di vita che cadeva dal cielo. Avrei dovuto scegliere in fretta quella giusta: la neve, si sa, non dura per sempre. O forse avevo già scelto, rimuovendo dalla memoria fatti, luoghi e facce di una vita artificiale.

Dopo anni di prigionia un improvviso eccesso di libertà sarebbe potuto risultare fatale, ma da mesi conviveva in me un preciso piano di fuga e la citofonata che interruppe le elucubrazioni mattutine confermava l’arrivo di un prezioso complice. “Scendi matta!” gracchiò Paolo nella cornetta.

Mentre caricava le valigie sull’automobile notò il mio sguardo assorto nello strato di neve che cresceva sulla strada e sugli oggetti urbani immobili, e disse: “Guarda che di quella ne vedrai quanta ne vorrai in Tibet!”

(nella foto: 12° laboratorio di scrittura creativa Rai Eri – Roma, 2012)

Laboratorio Rai “Il libro che non c’è”

Posted in nigrologia with tags , , , , , , , , , , , , , , , , , , on 8 maggio 2013 by Michele Nigro

 

Locandina Lab. giug 2013

Un laboratorio di scrittura a Napoli

Posted in nigrologia with tags , , , , , , , , on 27 dicembre 2012 by Michele Nigro

409411_10200314714174694_773801893_n

Commento a “L’uomo che non sapeva leggere”

Posted in nigrologia with tags , , , , , , , , , , , , , , on 21 maggio 2010 by Michele Nigro

“Farsi leggere!” Questo è uno dei primi consigli che generalmente viene dato a chiunque intenda intraprendere la dura e difficile strada della scrittura (non importa se creativa o non). Avere il coraggio di migliorarsi partendo dal giudizio (prezioso) del lettore, indipendentemente dalla “competenza” di quest’ultimo; essere in grado di integrare i giudizi positivi (capaci di suscitare solo un entusiasmo effimero e poco incisivo) con quelli apparentemente negativi ma in realtà costruttivi e duraturi; saper vivere i tempi della decantazione scritturale, seguita da un necessario labor limae con cui “togliere pezzi”; conquistare quella giusta consapevolezza che dovrebbe permettere all’aspirante scrittore di “contare fino a dieci” prima di cedere alla febbre adolescenziale della facile e rapida pubblicazione… Rileggersi di più, pubblicare di meno: per smorzare la vivacità allucinogena del presenzialismo cartaceo e per aumentare “scientificamente” la qualità di ciò che definiamo passione. In un paese come l’Italia in cui si stampano “tante cose”, si legge relativamente poco e l’editoria è di fatto in crisi, forse l’unica strada da perseguire è quella della qualità: cominciando da se stessi!

Ricevo e, per i motivi sopra esposti, volentieri pubblico il prezioso commento di Marco Papasidero, responsabile dell’iniziativa editoriale “Tempo vissuto – Racconti nel cassetto”.

<<Il racconto “L’uomo che non sapeva leggere” si presenta ben curato, piacevolmente caratterizzato da accostamenti linguistici tutto sommato originali e delicati. Il narrato è limpido e fluido, privo di sbavature, non contaminato da eccessive elucubrazioni retoriche. La trama non spicca per grande originalità. L’immagine dell’uomo che “non sa leggere” risulta un po’ stucchevole, così come il finale, non particolarmente d’impatto. Lo stile ricercato, che si arricchisce spesso di termini meno usuali, e per questo più “forti”, meriterebbe senz’altro un percorso di contenuto più originale. Avrebbe dato più spessore e profondità al racconto, e quindi al suo protagonista, una maggiore resa della sua psicologia, comunicata al lettore da pensieri, comportamenti, gesti. Infatti, nonostante in più punti si palesano abitudini e usi dell’uomo, questi ultimi tendono sempre a dare un’immagine, seppur linguisticamente incisiva, tutto sommato superficiale. Risulta altresì evidente che l’autore abbia cercato questa astrattezza delle immagini, volontà, credo, già resa manifesta dall’“uomo” volontariamente privo di nome, non identificato. Un uomo trasparente, quindi, privo di aspetto e realtà, fatto di gesti, elementi sui quali l’autore sembra aver voluto insistere particolarmente. Alla luce di tutti questi dati, il racconto è senz’altro un lavoro più che buono, particolarmente godibile per il linguaggio a tratti ricercato, e per la sintassi non solita. La trama invece non è propriamente avvincente, così come il titolo, che già svela il nocciolo del racconto, sottraendo al lettore il gusto di esplorare da sé, rigo dopo rigo, la vita e la strana abitudine del protagonista.>>

Responsabile Racconti nel Cassetto

Marco Papasidero

giornalista

www.tempovissuto.it

L’eugenetica del Dottor E

Posted in nigrologia with tags , , , , , , , , , , , , , , , , , , , , on 29 aprile 2010 by Michele Nigro

Prequel n.2

“L’eugenetica del Dottor E”

Nei laboratori della FutureProg.

Qualche anno prima della grande caccia al programma.

Mentre tamburellava con la matita sui raccoglitori accumulati nello scaffale e ripieni di analisi di laboratorio effettuate in quei duri anni di lavoro e di campionatura, il Dottor “E”, così l’avevano ribattezzato i suoi più stretti collaboratori lì alla FutureProg, non poté fare a meno di rimuginare sugli imprevisti e a dir poco sconvolgenti risultati segreti del beta testing di “Sion 2”.

Un nome biblico per un programma che avrebbe dovuto gestire il lavoro complesso e delicato dei tanti laboratori di analisi cliniche sparsi nel mondo e messi in rete. Se gli affari fossero andati come aveva previsto il fiducioso amministratore delegato direttamente piombato dalla sede centrale per assistere ai primi vagiti dell’applicazione – … il mondo non sarebbe stato più lo stesso… – queste le esagerate e ottimistiche parole usate dal pezzo grosso durante un’innocua pausa caffé. Parole a cui non aveva mai dato o non aveva mai potuto dare, in quanto reso inoffensivo dalla mancanza di dati più “intimi”, la giusta importanza.

– Chissà perché un nome biblico – continuava a chiedersi il Dottor “E”. Forse per impressionare gli informatori impegnati nei loro giri danteschi alla ricerca di possibili acquirenti o forse per impressionare gli stessi acquirenti, compresi i politici impegnati nella complessa gestione sanitaria dei paesi rappresentati, facendo leva sulla loro reverenziale coscienza religiosa collettiva ben nascosta tra le pieghe più arcaiche del cervello.

Ora, però, conosceva il vero perché di quel nome. Ma era troppo tardi. O forse no…

Dunque, i contagiosi “Protocolli dei Savi Anziani di Sion” avevano finalmente trovato la loro terapia globale in quel programma informatico capace di gestire, tramite la Rete, i dati di migliaia di laboratori sparsi nel mondo, in barba alle più elementari leggi sulla privacy con cui i politici si facevano belli dinnanzi alle telecamere e agli elettori.

Dopo l’eclatante fallimento nazista del secolo scorso e la storica diluizione degli sforzi eugenetici in tanti piccoli rivoli insignificanti, presto dimenticati, la subdola risposta all’oltraggiosa fondazione dello Stato di Israele si era trasformata con il tempo in uno dei progetti più capillari della storia umana. Chi, almeno una volta durante la propria vita e per i motivi più disparati, non aveva avuto bisogno di compiere delle semplici e routinarie analisi del sangue o non aveva depositato la propria saliva per un semplice test infettivistico? Tutti… Già, proprio tutti. Prassi quasi quotidiana nell’allarmistica e ben curata società del terzo millennio. Almeno in quella ricca, quella che conta dal punto di vista economico e tecnologico.

– Che ingenuo, sono stato! – pensava il rinsavito Dottor “E” mentre ripercorreva mentalmente le fasi più importanti dell’elaborazione del “Pacchetto Sion 2”. Non solo gestione dei dati in Rete, dunque, ma anche ricerca eugenetica camuffata da propositi umanistici e di ordine pubblico – L’Organizzazione Mondiale della Sanità ci ha chiesto espressamente di compiere una ricerca su vasta scala, tramite “Sion 2”, di quei fattori genetici che predisporrebbero gli individui all’uso di droghe e alcol… per bloccare l’impressionante parabola di omicidi, suicidi, incidenti stradali e sul lavoro, in tutto il mondo… – gli avevano detto alla vigilia del beta testing.

– Dottor “E”… “E” come Eugenetica! – rise amaramente – Dunque i miei più stretti collaboratori, i miei “amici” qui alla FutureProg, sapevano e sanno?

Ora tutte le tessere di quel mosaico invisibile ma reale si stavano riordinando pian piano nella sua sconvolta psiche di essere umano deluso e sfruttato. “Sion 2” avrebbe dovuto funzionare pressappoco così: il programma che gestiva il computer interno agli analizzatori, oltre a svolgere le sue normali e banali funzioni sequenziali, sarebbe stato in grado, parallelamente, di compiere una precisa e non autorizzata ricerca genetica sui campioni di sangue giunti in laboratorio. Una ricerca capace di stanare, negli anfratti cromosomiali delle cellule sanguigne, le più insignificanti tracce genomiche israelite tramandate nel tempo e insabbiate dai naturali incroci che la moderna e libera società globalizzata rendeva possibile ormai da decenni ai suoi inconsapevoli figli da redimere.

Tutto era cominciato alcune settimane prima.

Durante le fasi finali del beta testing, il Dottor “E” non riusciva a spiegarsi quella sigla cifrata che di tanto in tanto compariva al lato del numero di campione: … E-45671-I, E-45672-I, E-45673-I…

Il database aziendale non forniva risposte esaustive, ma forse il computer del Capo Sezione non gli avrebbe mentito. Così, durante una delle innumerevoli notti insonni trascorse a betatestare il mostro informatico dai mille volti, il Dottor “E” fece una visitina non autorizzata nell’ufficio del Capo Sezione. Conosceva la scarsa fantasia del soggetto e avrebbe scovato la password del suo personal computer in un batter d’occhio.

– Il fesso avrà messo sicuramente il nome della figlia! – ma cliccando su “invio” si accorse che il tizio, forse, aveva preso lezioni serali di furbizia e quindi avrebbe dovuto riprovare chissà per quante ore prima di beccare la password giusta.

– Dai, dimmi quale è la password: non hai una vita interessante! Sei monotono come il ticchettio di un orologio a corda… Sei noioso come una sinfonia di Berlioz… Sei prevedibile come la mia sveglia delle 7… Quale cacchio di password avrà mai potuto partorire la tua mente ammuffita? Rilancio con il nome di tua moglie, dal momento che la nomini trecento volte al giorno. Ma non può essere così facile! – invece lo era. – Confermo: sei un fesso!

La cartella intitolata “Sion 2” era come uno scrigno ricolmo di dolorose sorprese e finalmente, nel suo notturno curiosare a caccia di prove in grado di confermare i suoi striscianti sospetti, quel codice cifrato comparve seguito da una esaustiva legenda – Eccolo! E-xxxxx-I… – l’aveva trovato. Poi continuò a visionare stupefatto la spiegazione delle lettere e dei numeri che lo componevano – Dove “E” sta per (manco a dirlo!) Eugenetica, xxxxx è il numero ordinario dei campioni risultati “positivi” e “I” sta per… – fece una pausa durante la quale sentì il proprio cuore saltargli in gola come in preda a una sorta di danza ritmica – … sta per “Israelita”.

– Ma che c’azzecca con l’alcol e la droga? Quale interazione può esserci con delle normali analisi del sangue? – continuava imperterrito a tergiversare ingenuamente mentre la scottante realtà dei fatti gli tirava il camice da laboratorio come per dire “ehi, sono qui!”

Rielaborando le sconvolgenti scoperte durante le settimane successive, il Dottor “E” raggiunse finalmente quella serenità che deriva dalla totale, seppur dolorosa, presa di coscienza di uno stato di cose che avrebbe potuto definire fantascientifiche, ma che rappresentavano, invece, la realtà per cui aveva inconsapevolmente lavorato in quegli ultimi anni.

– Perché individuare proprio quella precisa traccia genica? – aveva continuato a indagare tra le possibili applicazioni di “Sion 2” – Perché evidenziare l’eredità genetica israelita negli esseri umani del terzo millennio?

Lentamente il disegno malvagio di selezione genetica insito nell'”innocuo” programma informatico, stava prendendo forma nella mente incredula e interrogativa del Dottor “E”.

“Sion 2” avrebbe dovuto completare su scala mondiale l’interrotta “Soluzione Finale” ideata dai nazisti di Hitler durante il cosiddetto “secolo breve”: estirpare dal DNA dell’Umanità ogni ombra sionista capace di minare la tanto agognata resurrezione della stirpe ariana.

Non più rastrellamenti, fucilazioni, ghettizzazioni, forni crematori, fosse comuni o improponibili campi di concentramento dove stipare i “pezzi” in attesa di macabre docce a base di Zyklon B; non più treni della morte e improbabili partiti nazionalsocialisti che sarebbero stati sbarazzati sul nascere da un’opinione pubblica assopita, è vero, dalla tecnologia e dalle nuove droghe mediatiche, ma ancora resa memore dall’immane quantità di dati e di immagini ereditate dalla terribile esperienza storica della Shoah.

“Sion 2” rappresentava la silenziosa e globalizzata ripresa di un discorso interrotto dalle mire espansionistiche di sovietici e americani, che intervennero durante la seconda guerra mondiale non certamente per motivi umanitari, ma per allargare, ognuno a modo proprio e seguendo una personale tempistica, i propri orizzonti ideologici e, non ultimi, commerciali.

Il muro di Berlino e la Guerra Fredda ne furono le prove più evidenti.

Stavolta no. L’epurazione sociale avrebbe sfruttato le normali e legali vie della competizione aziendale; il curriculum lavorativo di un soggetto sarebbe stato condizionato dai risultati delle analisi di “Sion 2”; il pestifero popolo israelita, ancora presente e perfettamente diluito tra le genti di tutto il mondo, sarebbe stato selezionato e messo al muro non grazie all’eliminazione fisica, come era accaduto in passato, ma utilizzando un’indolore e quasi impercettibile selezione socio-economica. Banditi dalle aziende, dai posti di lavoro, dalle cariche pubbliche, dalle responsabilità civili che rendono un soggetto umano indispensabile e utile… Tutto questo senza mai nominare la parola “israelita”.

Il trucco? Attribuire a quel codice cifrato una qualsiasi inventata malattia genetica irreversibile, una malsana predisposizione all’alcol e alla droga, un riconosciuto impulso all’omicidio, una dannosa aspirazione al suicidio. Una plausibile causa di licenziamento o di mancata assunzione. Tutte notizie personali false e non diffusibili, ma che l’Organizzazione Mondiale della Sanità, i Ministeri della Sanità delle varie nazioni e le numerose aziende del pianeta avrebbero senz’altro apprezzato, ufficiosamente, in termini di previsioni capaci di evitare fastidiose perdite di risorse umane e dispendiose cure da caricare sui bilanci assicurativi.

Isolare e distruggere socio-economicamente un’intera razza e le sue diramazioni genetiche: questo era lo scopo di “Sion 2”.

ATCGTAAGATCGATAGTCGATTAGCTGATCGATGCTAGCATTATGCTAGTA

CTAGCGACGACGATGCTAGCTAGCTAGCTGACTGGTGTCGTAGCTGATCG

GTGTATGAGAGATTTATTTCCCGCGAGTCAGTCAGTCAGTACGTCTGCTAG

TCTGACTACTGCTGCAGTCAGACTGCATGCTGCAGTCTGCATGATCAGCT

AGCTGACTGACTGCAGTCAGTCGCAGCGAGGGAGAAATTCTTCCTCTCCC

TAGCAGCTAGTGGCTGACGTAGCTAGCTGATGCTAGCTGATCGTAGCTGA

TCGATCGTAGCATGCTAGCTAGCGACGAGCTAGCTAGCTGATCGAGCTAG

CTGATCGATGCTAGCTAGCTAGCTGACTGACGATGCTAGCTAGCTAGCTA

GCTAGCTAGCTAGCGATCGATGCTAGCTAGCTAGCTGACTGATCGATGCT

AGCTAGCTAGCTGACTGATGCATGCTAGCTAGCTAGCTAGCTAGCTGACT

GATCGATGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTGATCGATCGATG

CTAGCTAGCTAGCTAGCTGATCGATGCTAGCTAGCTAGCTGACTAGCTGA

TCGATCGATGCTAGCTAGCTATAGCAGCAGCTAGCTAGCATGCTAGCATG

Gli antichi “mattoncini” del DNA messi al servizio, nuovamente, di una rediviva eugenetica nazista tecnologicamente avanzata. I subdoli obiettivi dei Savi di Sion sarebbero stati sbaragliati ancora una volta e il grande complotto sionista ai danni del mondo ariano non avrebbe visto, mai più, una nuova alba.

Amata scrittura

Posted in nigrologia with tags , , , , , on 12 aprile 2010 by Michele Nigro

Amata scrittura

Laboratorio di analisi, letture, proposte, conversazioni

di

Maraini Dacia

Un libro che è una testimonianza d’amore per la lettura e lo scrivere da parte di una grande autrice. In questo libro nato dalla trasmissione televisiva “Io scrivo, tu scrivi”, la Maraini ci conduce con leggerezza lungo i percorsi della scrittura. Ma non solo: oltre a analizzare i segreti dello scrivere, fa parlare autori come Isabel Allende, Andrea Camilleri, Maria Corti, Rosetta Loy, Mario Luzi, Elisabetta Rasy, Claudio Magris, chiamati a discutere sulla propria e altrui scrittura.

http://www.ibs.it/code/9788817128223/maraini-dacia/amata-scrittura-laboratorio.html

L'Ombra delle Parole Rivista Letteraria Internazionale

L'uomo abita l'ombra delle parole, la giostra dell'ombra delle parole. Un "animale metafisico" lo ha definito Albert Caraco: un ente che dà luce al mondo attraverso le parole. Tra la parola e la luce cade l'ombra che le permette di splendere. Il Logos, infatti, è la struttura fondamentale, la lente di ingrandimento con la quale l'uomo legge l'universo.

Also sprach

RIFLESSIONI E POESIE

Interno Poesia

Blog e progetto editoriale di poesia

Iannozzi Giuseppe - scrittore e giornalista

Iannozzi Giuseppe, in arte "Joseph Barbarossa" - scrittore, giornalista, critico letterario - blog ufficiale

Emanuele-Marcuccio's Blog

Per una strada e altre storie...

vibrisse, bollettino

di letture e scritture a cura di giulio mozzi

HyperHouse

NeXT Hyper Obscure

La legenda di Carlo Menzinger

libri: i miei, i tuoi, i suoi, i nostri, i vostri e i loro.

R. Tiziana Bruno

(ladri di favole)

DEDALUS: corsi, testi e contesti di volo letterario

Appunti e progetti, tra mura e spazi liberi

Poesia dal Sottosuolo

(prestarsi al mondo in versi)

Rivista ContemporaneaMente Versi

Rivista di Poesia Contemporanea Sperimentale e Non Solo

i sensi della poesia

e in pasto diedi parole e carne

La Camera Scura - il blog di Vincenzo Barone Lumaga

Parole, storie, pensieri, incubi e deliri

HyperNext

Connettivisti nel cyberspazio / Movimento in tempo reale

La Mia Babele

Disorientarsi..per Ritrovarsi

%d blogger hanno fatto clic su Mi Piace per questo: